ID: 1199963323

View in Genome Browser
Species Human (GRCh38)
Location X:152796958-152796980
Sequence CAGGCCCAACTCAACTGTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199963320_1199963323 -7 Left 1199963320 X:152796942-152796964 CCAGATTTACTGTGCCCAGGCCC No data
Right 1199963323 X:152796958-152796980 CAGGCCCAACTCAACTGTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199963323 Original CRISPR CAGGCCCAACTCAACTGTTG CGG Intergenic
No off target data available for this crispr