ID: 1199963756

View in Genome Browser
Species Human (GRCh38)
Location X:152801072-152801094
Sequence TGGTGGGGAGGGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199963756_1199963767 16 Left 1199963756 X:152801072-152801094 CCTTCCTCCCTCCCTCCCCACCA No data
Right 1199963767 X:152801111-152801133 CCCACACATCATTTTACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199963756 Original CRISPR TGGTGGGGAGGGAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr