ID: 1199968399

View in Genome Browser
Species Human (GRCh38)
Location X:152840134-152840156
Sequence ATGGTTTTTCAGCTCCGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199968399 Original CRISPR ATGGTTTTTCAGCTCCGTCA GGG Intronic
901489615 1:9589855-9589877 ATGGGTTTGCAGCTTCGGCAAGG + Intronic
904763922 1:32827388-32827410 AAGATTTTTCAGCTCTTTCATGG - Intronic
905891047 1:41518581-41518603 ATGGTTTCTCAGGCCAGTCAAGG + Intronic
907838358 1:58132610-58132632 ATGCTCCTTCAGCTCCTTCAGGG - Intronic
911121078 1:94297176-94297198 ATGTTGTTTCAGCTCTGTGATGG - Intergenic
912971890 1:114291446-114291468 ATGCTTTTTCAGCTCCTCCAGGG + Intergenic
916543730 1:165782839-165782861 CTTGGTTTTCAGCTCCATCAGGG + Intronic
918059949 1:181052489-181052511 ATGGTTCTTCAGGTCCCCCAGGG + Exonic
918384582 1:183992930-183992952 ATGGTTTATAAGCTCCATGAGGG + Intronic
918802119 1:188985804-188985826 TGTGTTTTTCAGCTCCATCAGGG + Intergenic
918925744 1:190783179-190783201 GTGGTTTTTCAGCATTGTCATGG - Intergenic
918933811 1:190893860-190893882 ATGCTTTTTCATCTCCTTCTTGG + Intergenic
920254162 1:204643007-204643029 AGGGTTCTTCATGTCCGTCATGG - Intronic
924111233 1:240701761-240701783 ATGGTTTTTGAGCTGTATCATGG + Intergenic
924735407 1:246751004-246751026 ATGTTGTTCCAGCTGCGTCAAGG - Intronic
1071782422 10:88861103-88861125 ATGGTCTTTCATCTCCTTCAGGG + Intergenic
1072225958 10:93369046-93369068 ATGGATTTTAAGCTCAGTGAAGG + Intronic
1072369187 10:94746247-94746269 GTGGTTTTTCAGCTCCATCATGG + Intronic
1073078982 10:100845194-100845216 ATGGATTTTCAACTACATCATGG + Intergenic
1074247112 10:111705877-111705899 ATTGTTTTATAGATCCGTCAGGG - Intergenic
1075869005 10:125754419-125754441 AGGGTTATTCATCTCCCTCAAGG - Intronic
1078863213 11:15272422-15272444 ATGCTTTTTCATCTCCGGGAGGG + Intergenic
1081296735 11:41399491-41399513 TTGGTTTTTCTTCTCCGTGAAGG - Intronic
1085252872 11:75155080-75155102 GTGGTTTCCCAGCTCAGTCAGGG - Intronic
1086067729 11:82764379-82764401 TGTGTTTTTCAGCTCCATCAGGG + Intergenic
1092180121 12:6441106-6441128 CTGGTGTGTCAACTCCGTCAGGG + Intergenic
1098286992 12:68917295-68917317 TTGGTTTGTCAACTCCTTCAGGG + Intronic
1100831431 12:98519660-98519682 ATGGCTATTAAGCTCAGTCAAGG - Intronic
1107666125 13:42693149-42693171 ATTCTTTTTCAGCTCAATCAGGG + Intergenic
1108681617 13:52785479-52785501 ATGGTTTTTGATCTCTGTAATGG + Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1110196899 13:72799934-72799956 GTGGTTTTTCTGCCCTGTCAAGG + Intronic
1111522686 13:89426864-89426886 ATGTGTTTTCAGCTCCATCCGGG + Intergenic
1113881865 13:113631482-113631504 ACGTTTTTCCTGCTCCGTCATGG + Intronic
1118936117 14:70289976-70289998 ATGGTTTGTCATCTTCGTCTAGG + Intergenic
1119367995 14:74111736-74111758 ATGATTTTTCTCCTCAGTCAAGG - Intronic
1120688909 14:87570569-87570591 ATGGTTTTCCAGCTACCTCTAGG - Intergenic
1122170981 14:99875528-99875550 GTGGTTTTTCAGCTCTTTAAGGG + Intronic
1123990519 15:25679952-25679974 ATTGTTTTTCAGATCCCTCCAGG - Exonic
1125117423 15:36111460-36111482 ATGATTTTTCACCTCCATGATGG + Intergenic
1127089858 15:55456662-55456684 ACGGTTTTTCAGCTGTTTCATGG - Intronic
1127148820 15:56052876-56052898 ATGGTATTTCAGCACTGGCAGGG + Intergenic
1128943917 15:71809029-71809051 ATGGGCTTTCAGCTCTGTCCCGG + Intronic
1131611698 15:93971175-93971197 ATGGTTTTTCTCCACCCTCAGGG + Intergenic
1132058485 15:98670448-98670470 ATGGTTTTCCAGGTCTGTAAAGG + Intronic
1141367501 16:83456995-83457017 CTGGCATTTCAGCTCCATCAGGG - Intronic
1143633995 17:8154113-8154135 ATGGTTTTTCTCCCCCTTCAGGG + Intronic
1146061683 17:29611165-29611187 ATGCTTTTTCACCTCGGACACGG - Intronic
1159013646 18:63083125-63083147 ATGATGTTTCAGCTTCGTCTGGG + Intergenic
925051019 2:815368-815390 ATGTTGTTTCAGTTCCATCATGG + Intergenic
927707401 2:25304914-25304936 AGGGTCTTTCAGCTCAGTCTAGG - Intronic
928170038 2:28997838-28997860 ATGCCTTTTCATCTCCTTCATGG - Intronic
930422142 2:51166514-51166536 ACGGTTTTTCAGCTGTCTCATGG + Intergenic
932428012 2:71655851-71655873 ATATTTGTTCAGCTCCGTTAGGG - Intronic
932558847 2:72849741-72849763 ATTGTTTTTCAGTTCAGGCACGG + Intergenic
934499579 2:94846291-94846313 ATTGTTTTTCAGTTCCATGAAGG + Intergenic
936589595 2:113790594-113790616 ATGGTTTTTCTGCTTCATCATGG + Intergenic
945285452 2:208077577-208077599 ACGGTTTTTCAGCTGTGTCTTGG - Intergenic
945576671 2:211539279-211539301 ATGGTTTTTCAATTCTGTCTTGG - Intronic
1171890814 20:30712998-30713020 ATTGTTTTTCAGTTCCATGAAGG + Intergenic
1175986891 20:62768508-62768530 ATGGAATTCCAGCTCAGTCATGG + Intergenic
1175993219 20:62799839-62799861 CTGGTCTTTCAGGTCCATCAGGG - Exonic
1176855646 21:13968247-13968269 ATTGTTTTTCAGTTCCATGAAGG + Intergenic
1177757228 21:25362173-25362195 ATGGTGTTCCTGCTCCCTCAAGG + Intergenic
1181345899 22:22220543-22220565 ATGGTTTTCCATCTCCCTTAGGG - Intergenic
951254350 3:20431950-20431972 TGTGTTTTTCAGCTCCATCAGGG + Intergenic
956825485 3:72993912-72993934 ATGGTTTTTCAGATCCCACCTGG - Intronic
957648092 3:82960890-82960912 TTGGTTTGTCAACTCCATCAGGG + Intergenic
965269225 3:166590866-166590888 AAGCTTTTTCAACTTCGTCATGG + Intergenic
965436963 3:168664368-168664390 ATGATTTTTCAGCTCAATAAAGG - Intergenic
966061656 3:175764221-175764243 ATGGTATTTCAGCTACATCTTGG + Intronic
977524190 4:98125007-98125029 TGTGTTTTTCAGCTCCATCAAGG + Intronic
977851505 4:101835768-101835790 ATGGTCTTTCAGCTCTTTGAAGG + Intronic
978093487 4:104746322-104746344 ATGGTTTTTCAGGTACGCCCAGG + Intergenic
980494038 4:133569144-133569166 TGTGTTTTTCAGCTCCGTCTAGG + Intergenic
982100505 4:151962675-151962697 GTGGTTTTTCAGTTGAGTCAGGG + Intergenic
982313732 4:154010633-154010655 TTGGCTTTTCAGATCAGTCAGGG - Intergenic
982421708 4:155207216-155207238 TTGGATTTTCAGTTCCTTCAGGG - Intergenic
995451039 5:112301135-112301157 ATGCTTTTTCAGGTCAATCAGGG + Intronic
1006047987 6:31315103-31315125 ATGGAATTTCAGCTTCTTCAGGG + Intronic
1007891000 6:45291453-45291475 ATTGTTTTTCAGGTACATCAGGG - Intronic
1023960232 7:44920470-44920492 AAGGTCTTGCAGCTCCGTGAAGG + Intergenic
1024398693 7:48898558-48898580 ATGGTTGTTCATCTCCGGCCAGG + Intergenic
1026883797 7:73924690-73924712 TGTGTTTTTCAGCTCCTTCAGGG + Intergenic
1031356398 7:120792212-120792234 ATGGGGTTGCAGCTCCTTCAAGG + Intronic
1031990833 7:128197856-128197878 CTGGTTTTCCAGCTCTGTCCAGG - Intergenic
1034427013 7:151019264-151019286 GTGGATGTCCAGCTCCGTCAGGG + Exonic
1034757971 7:153640827-153640849 GTGGTTTTTCAGACCCGTCCTGG - Intergenic
1038367105 8:26947750-26947772 ATTCTTTTTCAGCTAAGTCAGGG + Intergenic
1040373134 8:46796645-46796667 ATGGTTTTTCAACTCCATCCTGG + Intergenic
1041838190 8:62241069-62241091 TGTGTTTTTCAGCTCCATCAGGG + Intergenic
1044501171 8:92959779-92959801 ATGGTTTTTCAACTTCATGATGG - Intronic
1045299500 8:100899117-100899139 CTGGGTTCTCAGCTCCTTCAAGG - Intergenic
1053657580 9:40234249-40234271 ATTGTTTTTCAGTTCCATGAAGG - Intronic
1053791017 9:41686291-41686313 ATGCCTTTTCAGTTCTGTCAAGG - Intergenic
1053907942 9:42863526-42863548 ATTGTTTTTCAGTTCCATGAAGG - Intergenic
1054179363 9:61897985-61898007 ATGCCTTTTCAGTTCTGTCAAGG - Intergenic
1054358042 9:64082754-64082776 ATTGTTTTTCAGTTCCATGAAGG - Intergenic
1054369704 9:64380520-64380542 ATTGTTTTTCAGTTCCATGAAGG - Intronic
1054527016 9:66141979-66142001 ATTGTTTTTCAGTTCCATGAAGG + Intronic
1054658175 9:67682836-67682858 ATGCCTTTTCAGTTCTGTCAAGG + Intergenic
1054677331 9:67870273-67870295 ATTGTTTTTCAGTTCCATGAAGG - Intronic
1055618420 9:78097462-78097484 ATGATTCTTCCGCTCTGTCAGGG - Intergenic
1056486928 9:87068243-87068265 ATGGTATTTCAAGTCCTTCATGG - Intergenic
1060710590 9:125859942-125859964 GTGTTTTTTCAGTTCCCTCAAGG - Intronic
1061249853 9:129420357-129420379 AGGGCTGTCCAGCTCCGTCAGGG + Intergenic
1203560422 Un_KI270744v1:50767-50789 ATTGTTTTTCAGTTCCATGAAGG + Intergenic
1185874537 X:3691748-3691770 ATGGCAATTCAGCTCCATCAGGG - Intronic
1186167957 X:6846787-6846809 AAGGTGTTTCACCTCCCTCATGG - Intergenic
1190013036 X:46801787-46801809 TTGGTTTTTCAGCTCTTTCTTGG - Intergenic
1191099480 X:56710445-56710467 ATGCTCTTTCAGCTCAGTGAAGG + Intergenic
1197714798 X:129698965-129698987 ATGGACTGTCAGCTCCTTCAAGG - Intergenic
1199968399 X:152840134-152840156 ATGGTTTTTCAGCTCCGTCAGGG + Intronic
1200883176 Y:8241664-8241686 ATTCTGTTTCAGCTCAGTCAAGG - Intergenic
1200898867 Y:8407260-8407282 ATGGTTTTTAAGCTCCATCCTGG - Intergenic
1201397686 Y:13566515-13566537 ATTGTTTTGCAGCTCCTTCTGGG + Intergenic
1202249086 Y:22851337-22851359 ATGGTTTTTAAGCTCCATCGTGG - Intergenic
1202402074 Y:24485085-24485107 ATGGTTTTTAAGCTCCATCGTGG - Intergenic
1202468708 Y:25184998-25185020 ATGGTTTTTAAGCTCCATCGTGG + Intergenic