ID: 1199970676

View in Genome Browser
Species Human (GRCh38)
Location X:152858462-152858484
Sequence GTTCAGAGCAGGCACCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199970676_1199970683 5 Left 1199970676 X:152858462-152858484 CCTCCTAGGTGCCTGCTCTGAAC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1199970683 X:152858490-152858512 AAAAGGATGTTGCCTCTGTGTGG 0: 1
1: 0
2: 3
3: 23
4: 208
1199970676_1199970684 15 Left 1199970676 X:152858462-152858484 CCTCCTAGGTGCCTGCTCTGAAC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1199970684 X:152858500-152858522 TGCCTCTGTGTGGATCCCACAGG 0: 1
1: 0
2: 0
3: 27
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199970676 Original CRISPR GTTCAGAGCAGGCACCTAGG AGG (reversed) Intronic
900168722 1:1255785-1255807 GTTCTGAGCAGCCAGCTGGGTGG - Intronic
900210785 1:1454854-1454876 GTGGAGAGCAGGCACCTTGGGGG - Intronic
900216662 1:1485524-1485546 GTGGAGAGCAGGCACCTCAGGGG - Intronic
900223743 1:1523251-1523273 GTGGAGAGCAGGCACCTCGGGGG - Intronic
901637390 1:10676642-10676664 GTCGAGGGCAGGCACCAAGGTGG - Intronic
902130471 1:14256030-14256052 GTTGAAAGCAGACACTTAGGAGG - Intergenic
902545336 1:17186288-17186310 CTTCAGAGCCAGCACCTGGGCGG + Intergenic
902846060 1:19111454-19111476 GTTGAGAGCAGGCACCTGCCAGG - Intronic
903689208 1:25159101-25159123 CTCCAGAGTAGGTACCTAGGAGG - Intergenic
904300583 1:29550943-29550965 GTGCACAGCAGGGACCTGGGAGG + Intergenic
904408956 1:30313341-30313363 GTGCAGAGCAGGCACCTCTCAGG + Intergenic
904457623 1:30657101-30657123 GTGCACAGCAGGGACCTGGGAGG - Intergenic
905009719 1:34739196-34739218 AGTCAGAGGAGGCACCGAGGAGG - Intronic
905199805 1:36307834-36307856 GCTCAGAGTAGGCACAGAGGTGG + Intronic
905334684 1:37236353-37236375 GTTCAGAGCAAGGACCGGGGAGG + Intergenic
907411409 1:54286373-54286395 GTTTAGAGGAGGCACCTGGCTGG - Intronic
907526672 1:55057747-55057769 GGTCAGAGAAGGCATCTTGGAGG + Intronic
913130364 1:115833463-115833485 ATGCAGTGCAGGCACCAAGGGGG + Intergenic
915770413 1:158416474-158416496 GTTCAGAGAAGAAACCTTGGAGG - Intergenic
921346165 1:214187522-214187544 GCTCAGGGCAGGCGCCAAGGGGG + Intergenic
922243987 1:223777036-223777058 ATTCAGAGCAGAGACCCAGGAGG - Intergenic
1065645743 10:27831939-27831961 GGTCAAGGCAGGCACCTAGAAGG - Intronic
1070542296 10:77425008-77425030 GGCCAGGGCAGGCACCTGGGAGG + Intronic
1072521021 10:96230251-96230273 GATCACAGCAAGCACCTTGGTGG + Intronic
1073528773 10:104211726-104211748 GTGCAGGGAAGACACCTAGGTGG - Intronic
1075391393 10:122095136-122095158 GTTCAGCACAGGCATCTGGGGGG - Intronic
1077251998 11:1564839-1564861 GTTCAGAGCTGGGACATGGGAGG - Intronic
1079645737 11:22861890-22861912 GATCTGAGGAGGCTCCTAGGAGG - Intergenic
1080910199 11:36589140-36589162 GTTCAGAGAAGGCTTCTAGAGGG + Intronic
1083297550 11:61723208-61723230 GCTCAGAGCAGGCAGCTCTGTGG - Intronic
1084043068 11:66553916-66553938 TTTCAGGGCTGGCACCTAGTAGG - Intronic
1084998501 11:73007230-73007252 GTTCACAGCATGAACTTAGGTGG - Intronic
1085259157 11:75194418-75194440 GATGAAAGCTGGCACCTAGGTGG - Intronic
1086932694 11:92709720-92709742 ACACAGAGGAGGCACCTAGGTGG + Intronic
1089498565 11:118919836-118919858 GCTCAGAAAAGTCACCTAGGTGG - Intronic
1092174690 12:6395218-6395240 TTCCAGAGCAGGGACCTTGGTGG - Intergenic
1092969982 12:13684268-13684290 GTTCAAAGCAGGGATCTGGGAGG - Intronic
1093241979 12:16687883-16687905 GTTCATAGTAGGTACCTATGTGG + Intergenic
1095977759 12:47951415-47951437 GTTAAGAGCTGGCACCCTGGAGG - Intergenic
1097645150 12:62227285-62227307 GTTCAGAGCAGGCTTTTTGGGGG - Intronic
1103184078 12:118941236-118941258 GTTCAAAGCAACCATCTAGGTGG - Intergenic
1105214449 13:18276139-18276161 ATGCAGAGAGGGCACCTAGGGGG + Intergenic
1106140297 13:27006081-27006103 GTTCAGAGAGGGTACCTAGCTGG - Intergenic
1108628666 13:52258137-52258159 GATGAGAGCAGGGCCCTAGGTGG - Intergenic
1108657391 13:52548313-52548335 GATGAGAGCAGGGCCCTAGGTGG + Intergenic
1113466851 13:110518988-110519010 TTCCAGAGCAGGCACAGAGGAGG + Intergenic
1114617898 14:24077880-24077902 GGTCAGGACAGGCACCTGGGAGG - Exonic
1121629036 14:95409211-95409233 CCTCAGAGCAGCCAGCTAGGCGG - Intronic
1122029818 14:98904026-98904048 GTGCAGAACAGGCACAGAGGGGG - Intergenic
1122452525 14:101821746-101821768 TTTCAGACTAGGCATCTAGGAGG + Intronic
1125728635 15:41880812-41880834 GGTCAGGGAAGGCACCTTGGAGG - Intronic
1128218329 15:65949768-65949790 GTTCACTGCAGGCACCAAGGTGG + Intronic
1128575542 15:68772080-68772102 CTTGAGTGCAGGCACCAAGGAGG - Intergenic
1128891213 15:71333284-71333306 TTTCAGAGCAGGCATTTATGGGG + Intronic
1129607068 15:77030173-77030195 GTTCAGAGAAGGCAGCTGAGAGG - Intronic
1130729260 15:86473950-86473972 ATTCAGACCAGTCATCTAGGTGG - Intronic
1132573204 16:652987-653009 ACTCAGAGCAGGCACCCAGCAGG - Intronic
1133560131 16:6943078-6943100 ATTCAGAGCAGGTCCCCAGGAGG + Intronic
1135809875 16:25577393-25577415 GCACAGAGCAGGCCCCTGGGAGG - Intergenic
1142070350 16:88088377-88088399 GGGCAGAGCTGGCACATAGGAGG - Intronic
1142703479 17:1679002-1679024 GTCCAATGCAGGCACCTTGGTGG + Exonic
1142904784 17:3034423-3034445 GTTCTGATCAGGCCCCTGGGTGG + Exonic
1144320286 17:14110689-14110711 GTTCAGAGCAGAGAACTAGGAGG - Intronic
1144640619 17:16934616-16934638 GTGCAGAACAGGCACCTACCTGG + Intronic
1144789612 17:17850094-17850116 CTACAGAGGAGGCACCTAGGAGG + Intronic
1146605777 17:34256507-34256529 GTTCTGAATAGGCACCCAGGTGG - Intronic
1146624263 17:34424015-34424037 GTGCAGGGCAGGCAGCCAGGTGG + Intergenic
1147867628 17:43563684-43563706 GATCAGAGCAGCCTCATAGGAGG + Intronic
1150051215 17:61965093-61965115 GTTCAGAGTGGTCAGCTAGGAGG - Exonic
1150431695 17:65123291-65123313 GCCCAGAGCAGGGACCTAAGAGG + Intergenic
1152440846 17:80308549-80308571 GGACAGAGCAGGGACTTAGGAGG - Intronic
1152660194 17:81538480-81538502 GTTGAGAGCAGGTTCCTTGGAGG + Intergenic
1158413577 18:57230193-57230215 GTTCAGAGAAGGGACCAAGGAGG + Intergenic
1160227125 18:77020026-77020048 GGGCAGAGCAGGCAGCTATGTGG + Intronic
1160798084 19:954889-954911 GATCAGAGCAGGCCCCAGGGAGG + Intronic
1161597008 19:5155700-5155722 GTTGAGAGCAGGCACCTTCTAGG + Intergenic
1161846580 19:6714563-6714585 GTTAAGAACAGGGACCCAGGTGG + Intronic
1162049232 19:8022370-8022392 GTTTAAAGCAGGCACCGAGCAGG + Intronic
1163908027 19:20164613-20164635 GATCAGAGCAGAACCCTAGGGGG + Intergenic
1166329199 19:42069099-42069121 GCGCAGAGCAGGCCCCTAGTGGG + Intronic
1167493504 19:49805248-49805270 GGCCAAAGGAGGCACCTAGGGGG + Intronic
1168405554 19:56108448-56108470 GTCCAGAGGAGGCAGCTGGGAGG - Intronic
928344988 2:30484036-30484058 CTTCAGAGCAGTCACCTTAGAGG + Intronic
930695541 2:54407833-54407855 GTTCAGAGCAGAGACCTGGAGGG + Intergenic
932440138 2:71729598-71729620 TGTCAGATCTGGCACCTAGGGGG - Intergenic
934299874 2:91770600-91770622 ATGCAGAGAGGGCACCTAGGGGG - Intergenic
939299662 2:140319388-140319410 GTACAGAGGAGGCACCTGTGAGG + Intronic
939442605 2:142269132-142269154 GTTCAGAGCAGGTAAGTAGCGGG - Intergenic
941905713 2:170715399-170715421 GCTCAGAGCAGGCGCCAGGGAGG + Exonic
943968085 2:194364636-194364658 GTTCAGAGCAGGCAAGAATGTGG - Intergenic
946748103 2:222865647-222865669 GTGCAGAGCAGGCACAGAGTAGG + Intronic
948124785 2:235556536-235556558 GCTCTGACCAGGCACCTTGGGGG + Intronic
948211163 2:236194190-236194212 GTTCAGAACAGTCACCAATGTGG - Intergenic
1170945444 20:20887485-20887507 CTTAAAAGCAGGCTCCTAGGTGG + Intergenic
1172880191 20:38194849-38194871 GGTCAGGGAAGGCATCTAGGAGG + Intergenic
1174405491 20:50300287-50300309 ATTCAGAGAAGGCTCCTTGGAGG - Intergenic
1174718367 20:52784584-52784606 GTTCAGAGCACCTACCTAGGAGG - Intergenic
1175975895 20:62710329-62710351 GGTCAGGGCAGGCAGCTGGGAGG - Intronic
1178250656 21:31000380-31000402 GTTGAGAGAAGGCAGCTGGGAGG - Intergenic
1180067788 21:45421222-45421244 GCTCAAAGCAAGCACCTATGGGG - Intronic
1180123473 21:45769597-45769619 TTTCAGAGAAGGCACCTAAAAGG - Intronic
1181556123 22:23672592-23672614 ATGCAGAGAGGGCACCTAGGGGG + Intergenic
1181698225 22:24604696-24604718 ATGCAGAGAGGGCACCTAGGGGG - Intronic
1182035833 22:27197592-27197614 GTTCAGAGCCTGCACATAGTAGG + Intergenic
1182476431 22:30579073-30579095 GGCCAGAGCAGGCACCAAGCAGG + Intronic
1183306184 22:37084390-37084412 GTCCAGAGAGGGCACCTGGGAGG + Exonic
950466827 3:13160796-13160818 GCACAGAACAGGCACCCAGGGGG - Intergenic
954704427 3:52471641-52471663 GTGCCTAGCAGGCACCCAGGAGG + Intronic
956337331 3:68178523-68178545 GTTCAGGGAAGGCATCCAGGAGG + Intronic
960222716 3:115133582-115133604 GTCCAGAGTAGGCATATAGGTGG - Intronic
964177066 3:153836755-153836777 GTTCAGAGGAAGAAACTAGGAGG + Intergenic
965266847 3:166554326-166554348 GGTCAGAGCAGCAACCAAGGGGG + Intergenic
968439266 4:613332-613354 GGTCTGAGCAGGCACCATGGTGG - Intergenic
969427513 4:7134226-7134248 GTTCAGTGCAGGCCTCTAAGTGG + Intergenic
969427546 4:7134487-7134509 GTTCAGTGCAGGCCACTAAGTGG + Intergenic
969485907 4:7472297-7472319 ATTCAGGGCAGGCTTCTAGGAGG + Intronic
969808913 4:9632773-9632795 ATCCAGAGCAGGAACCTAAGGGG + Intergenic
976833043 4:89337031-89337053 GCTCAGAGAAGCCACCTTGGGGG - Intergenic
978154165 4:105471266-105471288 GGTCAGGGCTGGCACCAAGGAGG + Intronic
979277043 4:118825800-118825822 GTGCACAGCAGGCAGCTAGGTGG - Intronic
983984374 4:174040527-174040549 AGTCAGAGAAGGCTCCTAGGAGG + Intergenic
985016379 4:185639244-185639266 GCTCAGAGCAGGCAGCCGGGAGG - Intronic
985659623 5:1150386-1150408 GAACAGAGGAGGCACCTGGGTGG + Intergenic
986764795 5:10915663-10915685 GCTCAAAGCAAGCAGCTAGGAGG + Intergenic
989515578 5:42339130-42339152 TATCAGAGAAGGGACCTAGGAGG - Intergenic
990634830 5:57713092-57713114 TGCCAGAGCAGGCACCTATGGGG + Intergenic
998350483 5:141497221-141497243 GATCAGAGAAGGCTTCTAGGAGG + Intronic
999194373 5:149772067-149772089 GATCAGAGCAGGCCCCTCAGAGG - Intronic
1001205573 5:169759697-169759719 TTTCAAAGCCGCCACCTAGGTGG - Exonic
1001971373 5:175957464-175957486 GCCCAGAGCAGGCTCCTAGGAGG - Intronic
1002246069 5:177886313-177886335 GCCCAGAGCAGGCTCCTAGGAGG + Intergenic
1005801767 6:29432451-29432473 GTTGAGGGCAGGCTCCTGGGAGG - Intronic
1006175457 6:32118700-32118722 GGCCAAAGCAGGCAGCTAGGAGG + Intronic
1007166042 6:39829834-39829856 GTTCTGAGCCGGCCCCTTGGTGG + Intronic
1007792612 6:44320436-44320458 ATTCAGAGCAGGCAGATAGTTGG + Intronic
1010954161 6:82071318-82071340 GCACAGAGCAGGCACCGAGCAGG + Intergenic
1016123730 6:140374302-140374324 GTTCAAGGCAGGCGGCTAGGAGG + Intergenic
1018845371 6:167551911-167551933 GAACAGAGCAGGCCCCTGGGTGG - Intergenic
1019300640 7:301811-301833 TCGCAGAGCAGGCACGTAGGTGG + Intergenic
1022810435 7:33862716-33862738 GTTCAGAGCTGCAACCTACGAGG - Intergenic
1024006912 7:45231363-45231385 CTTCAAAGCAGGGCCCTAGGTGG - Intergenic
1024979130 7:55142867-55142889 CTTCAGAGCTGGCTCCTATGGGG - Intronic
1028888339 7:95959334-95959356 GTTCAGACCAGCAAGCTAGGAGG + Intronic
1037776829 8:21841069-21841091 GTGCACAGCAGCCACCTAGATGG - Intergenic
1044964560 8:97562591-97562613 GTGCAGAGTTGGCACCTAGAGGG - Intergenic
1048956568 8:139542308-139542330 TTTGAGAGTAGCCACCTAGGAGG - Intergenic
1049387731 8:142352800-142352822 GTTCAGAGCAAGGACGAAGGAGG + Intronic
1049655947 8:143797432-143797454 GTTCTGAGCGGGCCCCGAGGTGG - Intronic
1050448446 9:5752895-5752917 TTTCAGAGAAGGCACCTGTGAGG - Intronic
1051406782 9:16746164-16746186 GCTCAAAGCAGTCACCCAGGAGG + Intronic
1051742188 9:20262811-20262833 CTTCAGTGCAGACACCTAGGAGG - Intergenic
1052098702 9:24416088-24416110 GTTCAGAGCAAGCACAAAGATGG + Intergenic
1059764775 9:117373602-117373624 GTTCATAGAAGGAACCCAGGTGG + Intronic
1061004083 9:127918497-127918519 GCTCAAAGGAGGCCCCTAGGGGG - Intergenic
1061017644 9:127991218-127991240 GTTGTGAGCAGGTACCTAAGAGG - Intergenic
1061087904 9:128409814-128409836 GCTCAGAGCTGGTACGTAGGAGG - Intergenic
1061425243 9:130494406-130494428 GTCCAGTGCAGGCAGCTGGGTGG - Intronic
1061764842 9:132875206-132875228 GTGCAGGGCAGACACCCAGGTGG + Intronic
1187739537 X:22340700-22340722 GTACAGACCAAGCACCAAGGAGG + Intergenic
1188818045 X:34739508-34739530 GTTCAGATCTGGTACATAGGTGG + Intergenic
1190063266 X:47224114-47224136 GCTCAGAGCCGGCAGCTAGGTGG - Intronic
1197471653 X:126870448-126870470 GTTCAGAGTTGGGACCTAGCAGG - Intergenic
1199433387 X:147785975-147785997 TTGCAGAGCAGGCACTTAAGGGG - Intergenic
1199970676 X:152858462-152858484 GTTCAGAGCAGGCACCTAGGAGG - Intronic
1200075560 X:153548977-153548999 GTGCCGAGCAGGGACCCAGGGGG + Intronic
1200125976 X:153815231-153815253 GTTCAGAGCAGGGACCATGGTGG - Intronic