ID: 1199972645

View in Genome Browser
Species Human (GRCh38)
Location X:152872295-152872317
Sequence CAGTGTCCCCACAGCATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199972636_1199972645 15 Left 1199972636 X:152872257-152872279 CCCCCACCAGGCCAGGAGTTCTT No data
Right 1199972645 X:152872295-152872317 CAGTGTCCCCACAGCATAGTGGG No data
1199972637_1199972645 14 Left 1199972637 X:152872258-152872280 CCCCACCAGGCCAGGAGTTCTTA No data
Right 1199972645 X:152872295-152872317 CAGTGTCCCCACAGCATAGTGGG No data
1199972639_1199972645 12 Left 1199972639 X:152872260-152872282 CCACCAGGCCAGGAGTTCTTAAG No data
Right 1199972645 X:152872295-152872317 CAGTGTCCCCACAGCATAGTGGG No data
1199972642_1199972645 4 Left 1199972642 X:152872268-152872290 CCAGGAGTTCTTAAGGACAGAGG No data
Right 1199972645 X:152872295-152872317 CAGTGTCCCCACAGCATAGTGGG No data
1199972635_1199972645 19 Left 1199972635 X:152872253-152872275 CCTGCCCCCACCAGGCCAGGAGT No data
Right 1199972645 X:152872295-152872317 CAGTGTCCCCACAGCATAGTGGG No data
1199972638_1199972645 13 Left 1199972638 X:152872259-152872281 CCCACCAGGCCAGGAGTTCTTAA No data
Right 1199972645 X:152872295-152872317 CAGTGTCCCCACAGCATAGTGGG No data
1199972641_1199972645 9 Left 1199972641 X:152872263-152872285 CCAGGCCAGGAGTTCTTAAGGAC No data
Right 1199972645 X:152872295-152872317 CAGTGTCCCCACAGCATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199972645 Original CRISPR CAGTGTCCCCACAGCATAGT GGG Intergenic
No off target data available for this crispr