ID: 1199975081

View in Genome Browser
Species Human (GRCh38)
Location X:152890005-152890027
Sequence CTTGGATGGCAGAGGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199975077_1199975081 -6 Left 1199975077 X:152889988-152890010 CCATAGCAGGTACTAGACTTGGA No data
Right 1199975081 X:152890005-152890027 CTTGGATGGCAGAGGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199975081 Original CRISPR CTTGGATGGCAGAGGGAATG AGG Intergenic
No off target data available for this crispr