ID: 1199979505

View in Genome Browser
Species Human (GRCh38)
Location X:152913245-152913267
Sequence TTGTGGGCATGACAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199979505_1199979520 18 Left 1199979505 X:152913245-152913267 CCTGCTTCCTGTCATGCCCACAA No data
Right 1199979520 X:152913286-152913308 TATTTTGAGGCCCAAGGGTTCGG No data
1199979505_1199979510 5 Left 1199979505 X:152913245-152913267 CCTGCTTCCTGTCATGCCCACAA No data
Right 1199979510 X:152913273-152913295 AGCCCCCAGCCCCTATTTTGAGG No data
1199979505_1199979516 13 Left 1199979505 X:152913245-152913267 CCTGCTTCCTGTCATGCCCACAA No data
Right 1199979516 X:152913281-152913303 GCCCCTATTTTGAGGCCCAAGGG No data
1199979505_1199979515 12 Left 1199979505 X:152913245-152913267 CCTGCTTCCTGTCATGCCCACAA No data
Right 1199979515 X:152913280-152913302 AGCCCCTATTTTGAGGCCCAAGG No data
1199979505_1199979521 24 Left 1199979505 X:152913245-152913267 CCTGCTTCCTGTCATGCCCACAA No data
Right 1199979521 X:152913292-152913314 GAGGCCCAAGGGTTCGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199979505 Original CRISPR TTGTGGGCATGACAGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr