ID: 1199981360

View in Genome Browser
Species Human (GRCh38)
Location X:152922302-152922324
Sequence TTCCTCAGTGACTGAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199981360_1199981365 3 Left 1199981360 X:152922302-152922324 CCTGCCACTCAGTCACTGAGGAA 0: 1
1: 0
2: 2
3: 23
4: 380
Right 1199981365 X:152922328-152922350 CAGTCAGGGCACCTCCATGCTGG 0: 1
1: 0
2: 0
3: 16
4: 134
1199981360_1199981366 4 Left 1199981360 X:152922302-152922324 CCTGCCACTCAGTCACTGAGGAA 0: 1
1: 0
2: 2
3: 23
4: 380
Right 1199981366 X:152922329-152922351 AGTCAGGGCACCTCCATGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199981360 Original CRISPR TTCCTCAGTGACTGAGTGGC AGG (reversed) Intronic
900286974 1:1906502-1906524 TTCCTGAGTGACAGATTTGCTGG + Intergenic
900530714 1:3151683-3151705 TGCCAGAGTGTCTGAGTGGCCGG + Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
902980212 1:20117254-20117276 TTGCTCAGAGTCTTAGTGGCTGG + Intronic
905467659 1:38167509-38167531 TTCCTCAGTGACTCTGTATCAGG - Intergenic
907182381 1:52582368-52582390 TTCCTCAGTCTTTGAGTAGCTGG + Intergenic
907337463 1:53709800-53709822 CTGCTCAGTGACTGGGTGGGTGG + Intronic
909027475 1:70499884-70499906 TGACTCAGTGAGTGAGTGGTGGG - Intergenic
913330056 1:117659696-117659718 CTTCTCAGTGGCTGAGGGGCTGG + Intergenic
915092777 1:153438181-153438203 TTCCTCAGTGGCTGTGTGAGTGG - Exonic
916084652 1:161259466-161259488 TTCCTGACTGAATGAGTGGAGGG - Intronic
916378869 1:164186963-164186985 TTGCTGATTTACTGAGTGGCTGG + Intergenic
917085443 1:171300051-171300073 TTCCTCAGTGGCTTAGTGAGTGG - Intergenic
919479665 1:198072419-198072441 TTCCTCAGTGACTGATGTGATGG + Intergenic
919824403 1:201493282-201493304 TTCCTGAGTGTCTGAATGGGCGG - Intronic
920822820 1:209397307-209397329 TTCCTCAGTTAGTGAGTGGTGGG - Intergenic
921860040 1:220033116-220033138 TTGCTCAGTGAGTGTGTGACTGG - Intronic
922395068 1:225190356-225190378 TTACTGAGTGACTGATTAGCAGG + Intronic
922612842 1:226942654-226942676 ATCTTCAGGGAGTGAGTGGCTGG + Intronic
924581718 1:245329573-245329595 TTCTGCAGTGGCTGAATGGCTGG + Intronic
1064561328 10:16597829-16597851 TTCCTCAGTGAGTCATCGGCAGG + Intronic
1065223390 10:23518717-23518739 TGCCTCAGTTCCTGAGTAGCTGG + Intergenic
1065359552 10:24876842-24876864 TTCCTCAGGGGCTGAGTCGGGGG - Intronic
1065362237 10:24899370-24899392 TTCCTTTGTGACTGTGTGGTTGG + Intronic
1065529295 10:26652781-26652803 GTTCTCAGTGACTGAGGGACGGG + Intergenic
1066553747 10:36587902-36587924 TGCCTCAGCGCCTGAGTAGCTGG - Intergenic
1067677050 10:48390442-48390464 TACCTCAGTGACTTATTGCCAGG + Intronic
1067713697 10:48671238-48671260 TTCCCCAGTGACTGAGGGCAGGG + Intergenic
1069024391 10:63523520-63523542 TACCTCAGTCCCTGAGTAGCTGG - Intronic
1070292404 10:75126807-75126829 ATCCTCAGTGCCTTAGTGTCTGG + Intronic
1070482369 10:76895344-76895366 TTCCAAAGTGACTGTGTAGCAGG - Intronic
1070830168 10:79413294-79413316 TCACACAGTGAGTGAGTGGCGGG + Intronic
1071332535 10:84574322-84574344 TGCCTCTGTGAGTGAGTGCCTGG + Intergenic
1072464549 10:95651017-95651039 TGCCTCAGTTCCTGAGTAGCTGG - Intronic
1072526918 10:96280122-96280144 TACCTCAGTGCCCGAGTAGCTGG + Intergenic
1072691198 10:97573213-97573235 TGCCCCAGTGACTGAGTGGGAGG + Intronic
1072812235 10:98471081-98471103 GTTCTCTGTGACTGAGTGGAAGG - Intronic
1072813201 10:98479700-98479722 TTTCACAGTGAATTAGTGGCAGG + Intronic
1073265223 10:102223987-102224009 CTCCTCAGTCCCTGAGTAGCTGG + Intergenic
1073784450 10:106873187-106873209 TTCCTGAGTACCTGAGTAGCTGG - Intronic
1075402021 10:122167800-122167822 CTTCTGAGTGACTGAGAGGCTGG - Intronic
1075463334 10:122632951-122632973 TTCCTCAGTGACAATGGGGCTGG + Intronic
1077136428 11:1001702-1001724 CTCCTCAGTGTCTTGGTGGCAGG + Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1078550709 11:12278773-12278795 TTCCAGAGTGACTGAATGGCTGG + Intronic
1079211617 11:18465917-18465939 TTGCTCAGTACCTGGGTGGCAGG - Intronic
1079469313 11:20763316-20763338 TTCCTCCATGCCTGAGTGCCAGG - Intronic
1079840790 11:25397096-25397118 TGGCTCAGTCACTGACTGGCAGG - Intergenic
1080092608 11:28366230-28366252 TGACTCAGTGACTCAGTGGAGGG + Intergenic
1083080617 11:60088848-60088870 ACCCTCAGTCACTTAGTGGCAGG + Intronic
1083813737 11:65120143-65120165 TACCTCTGTGACTGCCTGGCCGG - Intergenic
1085325779 11:75605611-75605633 TGCTTCACAGACTGAGTGGCAGG - Intronic
1086158706 11:83696452-83696474 TTACTGACTGACTGACTGGCTGG - Intronic
1088426273 11:109707573-109707595 TTCCTCAGTGACTGTAATGCTGG - Intergenic
1089697379 11:120224596-120224618 GTACTCAGTGACTGTGTGGTGGG + Intronic
1090153599 11:124412321-124412343 TGAGTCAGTGAGTGAGTGGCAGG + Intergenic
1090972211 11:131653556-131653578 TGCCACAGTGGCTGAGTGGAGGG + Intronic
1091379997 12:51474-51496 TTAGTCAGTGACTGAGTGAGCGG - Intergenic
1092844537 12:12571786-12571808 TGCCTCAGTCTCTGAGTAGCTGG - Intergenic
1092903901 12:13085003-13085025 TCCCTCAGAGACAGAGTGGATGG + Exonic
1095372072 12:41480292-41480314 TTGCTCAGTCACCAAGTGGCTGG + Intronic
1095503271 12:42864616-42864638 TTCCTCAGCCTCTGAGTAGCTGG + Intergenic
1096740491 12:53690332-53690354 TCACTCAGTGAGTGAATGGCAGG - Intergenic
1096790928 12:54044416-54044438 TTCCTTTGTGACTGAGGGGTTGG - Intronic
1097913504 12:64995583-64995605 CTACTCAGAGACTGAGAGGCAGG - Intergenic
1097986165 12:65785441-65785463 TTCTTCAGTCACTGAGTACCAGG + Intergenic
1098552988 12:71784976-71784998 TGCCTCAGTCCCTGAGTAGCTGG - Intronic
1099192078 12:79571089-79571111 TGCCTCAGTACCTGAGTAGCTGG + Intergenic
1100549991 12:95638380-95638402 TTCCTCAATGAGTGAGTGCTGGG + Intergenic
1102382620 12:112480478-112480500 TGCCTCAGTGCCTGAGTAGCTGG + Intronic
1102723462 12:115037623-115037645 TGCCTCAGTCTCTGAGTAGCTGG + Intergenic
1103225270 12:119282124-119282146 TTCCACAGCTAGTGAGTGGCAGG - Intergenic
1104080990 12:125430479-125430501 TCCCCAAGTCACTGAGTGGCTGG - Intronic
1104467339 12:129001364-129001386 TCCCTCAGTGACTGTGTCTCTGG + Intergenic
1105630687 13:22162549-22162571 TGCCTCAGCATCTGAGTGGCTGG - Intergenic
1105740819 13:23321577-23321599 CTCCTCAGTGACTCACGGGCTGG + Intronic
1106552534 13:30784651-30784673 TTCCTCATTCACTGAGTACCGGG - Intergenic
1106718063 13:32411816-32411838 TTTCTCAGTGAGTGACTGACTGG - Intronic
1107203169 13:37747286-37747308 TTCCTCAGTGAGTAAGTGGAAGG + Intronic
1109243785 13:59927586-59927608 TCCCTCAGTGTTTGATTGGCTGG + Intronic
1109504282 13:63279443-63279465 CTACTCAGTGACTAAGGGGCAGG - Intergenic
1110213314 13:72998359-72998381 TGCCTCAGTGCCTGAGTAGCTGG - Intronic
1110530078 13:76586909-76586931 TGCCTCAGTCTCTGAGTAGCTGG - Intergenic
1111277117 13:85965061-85965083 CTCCTAAGTGACTAAGAGGCAGG - Intergenic
1112351204 13:98635130-98635152 TTCCTCAGCCTCTGAGTAGCTGG - Intergenic
1115252084 14:31359610-31359632 TGCCTCAGTCTCTGAGTAGCTGG - Intronic
1117308093 14:54496070-54496092 TGCCTCAGTTTCTGAGTAGCTGG + Intergenic
1118189094 14:63564455-63564477 TTCCTGAGAGACTGTGTGGGGGG - Intergenic
1119041234 14:71276564-71276586 CTCCTCAGTGACTGGTTGGTTGG - Intergenic
1119222988 14:72924560-72924582 TTGCTGAGTCAATGAGTGGCTGG - Intergenic
1119228806 14:72964056-72964078 TGCCTCCGTGACTCAGTGGCGGG + Intergenic
1119338578 14:73855558-73855580 TGCCTCAGTCTCTGAGTAGCTGG + Intronic
1119596488 14:75939497-75939519 TGCCTCAGCCCCTGAGTGGCTGG + Intronic
1119758421 14:77134743-77134765 TTCCTCAGAGTTTGGGTGGCTGG + Intronic
1121172305 14:91864893-91864915 TGCCTCAGTCTCTGAGTAGCTGG + Intronic
1121946901 14:98131856-98131878 ATGCTCAGTGGCTGTGTGGCTGG + Intergenic
1122694457 14:103545998-103546020 TGCCTCAGTGACCCTGTGGCAGG + Intergenic
1122954790 14:105065563-105065585 TTCCTGAGGGAGGGAGTGGCAGG + Intergenic
1123810067 15:23915835-23915857 TGCCTCAGTCTCTGAGTAGCTGG - Intergenic
1126232517 15:46343820-46343842 TTTCTCTGTCAGTGAGTGGCGGG + Intergenic
1128313249 15:66644744-66644766 TACCCCAGTGACTGAGTAGGGGG + Intronic
1128475384 15:67992912-67992934 TTGCCCAGTGAGTCAGTGGCAGG + Intergenic
1129261394 15:74369895-74369917 TTTCTGGGTGACTGGGTGGCTGG + Intergenic
1129320379 15:74771426-74771448 TGCCTCAGTCTCTGAGTAGCTGG + Intergenic
1131162629 15:90117591-90117613 TGCCTCAGTCTCTGAGTAGCTGG + Intergenic
1131266196 15:90916733-90916755 TGCACGAGTGACTGAGTGGCGGG - Intronic
1131617181 15:94028862-94028884 TTCATGAATGACTGACTGGCAGG + Intergenic
1132671906 16:1105557-1105579 CTGCTCTGGGACTGAGTGGCTGG - Intergenic
1133060746 16:3173025-3173047 TTCCTCAGCTTCTGAGTAGCTGG + Intergenic
1133131240 16:3677225-3677247 TTTCTCAGTGGCTGAGCTGCAGG - Intronic
1133570434 16:7034960-7034982 TTCCTCAGCCTCTGAGTAGCTGG + Intronic
1133880842 16:9780045-9780067 TTCATCAGTGGCTGTGTGGTTGG - Intronic
1135026010 16:18999603-18999625 TTTCTGAGTGACTGACTGGTGGG + Intronic
1137253856 16:46759348-46759370 TTGCTCAGTGAATGAATGGATGG - Intronic
1137386643 16:48048345-48048367 TTCCTCAGTGGGAAAGTGGCAGG - Intergenic
1139430583 16:66909047-66909069 TTGCACATTGACTGTGTGGCAGG - Intronic
1140179749 16:72703093-72703115 TGCCTCAGCCACTGAGTAGCTGG + Intergenic
1141142471 16:81505671-81505693 CTCCTCAGTGAAAGAGTGGCTGG + Intronic
1142890308 17:2938870-2938892 TGCCTCAGTCCCCGAGTGGCTGG - Intronic
1142960500 17:3549514-3549536 TTCATCAGTGAATGAGTGGGAGG + Intronic
1144651059 17:17007223-17007245 TGCCTCAGCGTCTGAGTAGCTGG - Intergenic
1144759209 17:17697957-17697979 TTGCGCACTGACTGAGTTGCTGG + Intronic
1145954144 17:28842879-28842901 TTCCTCAGTGCCTGATGGTCTGG + Intronic
1146190064 17:30757078-30757100 TGCCTCAGTCTCTGAGTAGCAGG - Intergenic
1146334964 17:31961430-31961452 TGCCTCAGTCTCTGAGTAGCTGG - Intronic
1146829908 17:36059495-36059517 TTCCTCAGTGAGTGGGTGATCGG + Intergenic
1147278137 17:39336003-39336025 TTCCTCAGCTCCTGAGTAGCTGG - Intronic
1147632974 17:41944248-41944270 TGCCTCAGCCACTGAGTAGCAGG - Intronic
1147741893 17:42674725-42674747 TTCCACAGTGAGTTAGTGGTGGG - Intronic
1148497655 17:48062961-48062983 TGCCTCAGTCTCTGAGTAGCTGG - Intergenic
1148914308 17:50961521-50961543 TTCCCCAGGGACTAAGGGGCAGG + Intergenic
1150643047 17:66962593-66962615 TTCCTGAGTAACCCAGTGGCTGG + Intergenic
1152850562 17:82631965-82631987 TGCCTCAGCTCCTGAGTGGCTGG - Intronic
1154282119 18:13013359-13013381 ATCCTGAGTGCCTGAGTGTCTGG + Intronic
1155914978 18:31548084-31548106 TTTCTCAGTTATTGACTGGCTGG + Exonic
1155946323 18:31856218-31856240 TGCCTCAGTCTCTGAGTAGCTGG + Intronic
1156447730 18:37249579-37249601 CTCCTCAGGGACTGAGTGTGAGG - Intronic
1156450711 18:37264868-37264890 GTCCTAAGTGGCTGAGTGGCAGG - Intronic
1156686292 18:39651016-39651038 CTACTCAATGACTGTGTGGCTGG - Intergenic
1157825702 18:50810077-50810099 TGCCTCAGCCTCTGAGTGGCTGG + Intronic
1159053307 18:63441724-63441746 TTCCTCAAACACTGAGTGTCTGG - Intergenic
1159500948 18:69268936-69268958 TTCTTCAGTGTCTATGTGGCAGG + Intergenic
1161293901 19:3509946-3509968 TTGCTCTGTGACTGAGGCGCTGG + Intronic
1163508467 19:17721645-17721667 TGCCTGAGTGACAGAGTGGGAGG + Intronic
1163811217 19:19432993-19433015 TTCCTGAGTGACTGGGTGGTGGG + Intronic
1163908275 19:20167090-20167112 TCACTCAGGGACTGAGTGGGCGG + Intergenic
1164621289 19:29697389-29697411 TGTCCAAGTGACTGAGTGGCAGG - Intergenic
1164650349 19:29886851-29886873 TTCCACAGTGACTCTGGGGCAGG + Intergenic
1165502797 19:36203483-36203505 TTCCCCATTGACTGTGAGGCTGG + Intronic
1166551707 19:43669881-43669903 TTCCTTAGCTACTGAGTGCCAGG + Intronic
1166920852 19:46228100-46228122 TGCCTCAGTCTCTGAGTAGCTGG - Intergenic
1167555696 19:50193987-50194009 TGCCTCAGTCTCTGAGTAGCTGG + Intronic
1167655627 19:50762121-50762143 TGACACAGTGACTGAGTGCCAGG + Intergenic
1167657408 19:50774122-50774144 TGACACAGTGACTGAGTGCCAGG + Intergenic
1202633060 1_KI270706v1_random:17719-17741 TGCCTCAGTTCCTGAGTAGCTGG + Intergenic
925228534 2:2208156-2208178 TTCCCCAGTGAATGAATGGTGGG - Intronic
925429402 2:3778161-3778183 TTCCTGAGTGGCTGTGTGGACGG + Intronic
926348695 2:11975274-11975296 TTCCTCAGTGGCTGAGGGTATGG + Intergenic
926356023 2:12041338-12041360 CTCCACAGTGAATGAGTGCCAGG + Intergenic
926837839 2:17044183-17044205 TTCCTCAGTGACTGGGCAGGAGG - Intergenic
928171552 2:29007670-29007692 TTCCTGATTGAATGAATGGCGGG + Intronic
929711067 2:44267162-44267184 TTCCTCAGTTTCCGAGTAGCTGG - Intergenic
929810442 2:45185026-45185048 TCCCACAGTGACAGAGTGCCTGG - Intergenic
930751969 2:54943131-54943153 TTTCTCAGTGAAGGAGGGGCAGG - Intronic
933281115 2:80333736-80333758 TGCCTCAGACTCTGAGTGGCTGG + Intronic
933780562 2:85797777-85797799 TGCCTCAGCGTCTGAGTAGCTGG + Intergenic
933984439 2:87578923-87578945 TTGCTCTGAGACTGTGTGGCTGG + Intergenic
934495204 2:94789956-94789978 TTCCTGAGTGTCAGAGTGGGAGG + Intergenic
934523977 2:95039569-95039591 TGAGTCAGTGACTGAGTGGGTGG + Intronic
936401982 2:112171567-112171589 TTACTGAGTAACTGACTGGCTGG + Intronic
936563876 2:113567368-113567390 TTAGTCAGTGACTGAGTGAGCGG + Intergenic
938164231 2:129011992-129012014 TTCTTCAGTGGCAGATTGGCGGG - Intergenic
938398250 2:130966119-130966141 TTCCTCAGTGCCTCTGTGGCTGG - Intronic
938925540 2:136037938-136037960 ATGCTCAGTGTCTGAGTGACGGG - Intergenic
941808017 2:169728858-169728880 TGCCTCAGTCTCTGAGTAGCTGG + Intronic
942249282 2:174033963-174033985 TGACTCAGAGTCTGAGTGGCTGG + Intergenic
943840518 2:192574435-192574457 TGCCTCAGTCTCTGAGTAGCTGG - Intergenic
944037580 2:195314193-195314215 ATTCTCTGTGACTGAGTTGCAGG + Intergenic
944150005 2:196547835-196547857 TTCCTCACTGACTGTGAAGCTGG - Intronic
945648704 2:212534585-212534607 TCCTGCAGTGGCTGAGTGGCAGG + Intronic
948275313 2:236703994-236704016 TTCCTCAGGGACAGTGAGGCAGG + Intergenic
948330054 2:237157421-237157443 TCACTCAGCTACTGAGTGGCGGG + Intergenic
949062827 2:241971100-241971122 TTCCTCATTGACTGAGTAAATGG - Intergenic
1168953438 20:1818023-1818045 TTCCTCAGTGCCTGAGAGTGGGG - Intergenic
1169429860 20:5526577-5526599 TTCCTCTGAGACTGAGAGGTAGG + Intergenic
1169598197 20:7225769-7225791 TTCCTCAGTGACTTAGGGAGTGG + Intergenic
1170693599 20:18637285-18637307 TTCATCACTGCCTGTGTGGCAGG - Intronic
1171254819 20:23681811-23681833 TTTCTCAGTGACTGCTTGTCTGG + Intergenic
1172131607 20:32659723-32659745 TCCCACAGTGACTGTGTGGCAGG + Intergenic
1173197855 20:40930867-40930889 TTTCTCAGGGTCTGAGGGGCAGG - Intergenic
1173600067 20:44288457-44288479 TTGCTCAGTGACTTAGTGAAAGG + Intergenic
1173901713 20:46595411-46595433 GTCAGCAGTGACTGGGTGGCCGG - Intronic
1174197172 20:48781683-48781705 TTCCACAGTGAGTTTGTGGCAGG - Intronic
1175193626 20:57227587-57227609 TTACTCAGTGGCTGGGTTGCTGG - Intronic
1175330348 20:58159399-58159421 TGCCTCAGCTCCTGAGTGGCTGG - Intronic
1175506577 20:59490036-59490058 TGCCTCAGCCACTGAGTAGCTGG - Intergenic
1177520941 21:22224640-22224662 TTCATCAGGGACTGAATGGCTGG - Intergenic
1178257547 21:31068190-31068212 TTCCTCAGTGAATGAATGAGCGG - Intergenic
1178348027 21:31848910-31848932 TTCCTCACTTACTGCCTGGCAGG - Intergenic
1178393009 21:32214794-32214816 TGGCACAGTGAGTGAGTGGCAGG - Intergenic
1179344680 21:40545835-40545857 TTTCTCAGTGACAGACTGGCTGG - Intronic
1179515078 21:41900656-41900678 TTCCTCAGTGGCTGGGAGACAGG - Intronic
1179924132 21:44523266-44523288 TACCTCACTGACTAATTGGCTGG - Intronic
1185349785 22:50328641-50328663 TACCTAGGAGACTGAGTGGCAGG - Intergenic
1185367897 22:50445376-50445398 GTCCTCAGTGGCTGAGTGGGAGG + Exonic
1185373716 22:50472500-50472522 TTCATTAGTGACTGAGCAGCAGG - Intronic
949852157 3:8430220-8430242 TTCCTAAGGTCCTGAGTGGCAGG - Intergenic
950940555 3:16885883-16885905 TTTCTTTGTGACTGAGTGACCGG - Intronic
950949093 3:16980159-16980181 TCCCTCCTGGACTGAGTGGCTGG + Intronic
952186997 3:30980778-30980800 TGCCTCAGTCACTGAGTATCTGG + Intergenic
952969475 3:38641748-38641770 TTCATCAGTGTCTGGGTGCCAGG + Intronic
953371578 3:42393043-42393065 ATCTTCAGTGAATGAGGGGCAGG + Intergenic
956736431 3:72242138-72242160 TGCCTCAGTTCCTGAGTAGCTGG - Intergenic
960143229 3:114171612-114171634 TTCCTCAGTTCCTGACTGTCTGG + Intronic
960531705 3:118772786-118772808 TTTCTCAATCACTGAGTGGGAGG - Intergenic
961236050 3:125368829-125368851 TGCCTCAGTCTCAGAGTGGCTGG - Intronic
961546692 3:127639250-127639272 TTCCTGGGTGCCTGTGTGGCTGG + Exonic
961569176 3:127785949-127785971 CCCCTGAGTGTCTGAGTGGCTGG + Intronic
962516574 3:136157387-136157409 TGCCTCAGTCTCTGAGTAGCTGG - Intronic
962851705 3:139313037-139313059 TTGCTCAATGACTCAGAGGCAGG - Intronic
963083226 3:141413836-141413858 ATCTTCAGAGACAGAGTGGCAGG - Intronic
963917865 3:150876589-150876611 TACCTCAGTGACTTAGTGGCAGG + Intronic
964491792 3:157243926-157243948 TCCCTCAGCCCCTGAGTGGCTGG - Intergenic
965068031 3:163878014-163878036 TTCAGCAGTGTCTGAGTGACAGG + Intergenic
965604113 3:170482694-170482716 TCCCTCAGCTACTGAGTGGCAGG - Intronic
968844118 4:3030354-3030376 TCCCTCACTGATTGAGTGTCTGG - Intronic
968913935 4:3489044-3489066 GTCCTCTGCGACTGAGTGGCAGG - Intronic
970257313 4:14182002-14182024 TGCCTCAGTCTCTGAGTAGCTGG - Intergenic
970512226 4:16792753-16792775 TTGCTCAGTGACTTACAGGCAGG + Intronic
971306224 4:25484016-25484038 TGCCTCAGTCTCTGAGTAGCTGG + Intergenic
972615888 4:40697671-40697693 TTCCTCAGTCTCCGAGTAGCTGG - Intergenic
973760219 4:54108666-54108688 TTCCTAATTGACTGAGGGGCAGG + Intronic
974181320 4:58387236-58387258 TTCATAACTGACTAAGTGGCTGG - Intergenic
976786755 4:88830106-88830128 TTCTTCTGCTACTGAGTGGCAGG + Intronic
978211301 4:106139206-106139228 TTCCTCAGGGAATAAGTGTCTGG - Intronic
978429952 4:108623216-108623238 TGCCTCAGTCTCTGAGTAGCTGG - Intronic
979431662 4:120639700-120639722 TTCCTCAGCCTCTGAGTTGCTGG - Intergenic
979863900 4:125728928-125728950 TCCCTCTGTGACTGTGAGGCAGG - Intergenic
980255196 4:130371299-130371321 TTCCTCAGCCTCTGAGTAGCTGG - Intergenic
980268104 4:130546378-130546400 TGCAACAGTGACTGAGCGGCAGG - Intergenic
980803342 4:137781770-137781792 TGCCTCAGTTCCTGAGTAGCTGG + Intergenic
982182524 4:152762947-152762969 TGCCTCAGACACTGAGTAGCTGG + Intronic
982223293 4:153142733-153142755 TGCCTCAGTCACTGAGTAGTGGG - Intergenic
983059487 4:163141248-163141270 TGCCTCAGCCCCTGAGTGGCTGG - Intronic
983389771 4:167114596-167114618 TTCAGCAGTCACAGAGTGGCAGG + Intronic
984128832 4:175847495-175847517 CTACTAAGTGACTGAGTGGTGGG - Intronic
985333433 4:188866394-188866416 TTTCTCTGTGATTGATTGGCAGG - Intergenic
985517902 5:356506-356528 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985517917 5:356568-356590 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985517930 5:356630-356652 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985517943 5:356692-356714 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985517958 5:356754-356776 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985517973 5:356816-356838 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985517988 5:356878-356900 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518001 5:356940-356962 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518016 5:357002-357024 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518029 5:357064-357086 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518044 5:357126-357148 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518057 5:357188-357210 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518072 5:357250-357272 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518085 5:357312-357334 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518098 5:357374-357396 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518111 5:357436-357458 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518158 5:357622-357644 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518186 5:357746-357768 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518198 5:357808-357830 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518211 5:357870-357892 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518258 5:358056-358078 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518286 5:358180-358202 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518298 5:358242-358264 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518311 5:358304-358326 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518358 5:358490-358512 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518371 5:358552-358574 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518385 5:358614-358636 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518398 5:358676-358698 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518411 5:358738-358760 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518473 5:358986-359008 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518485 5:359048-359070 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518498 5:359110-359132 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518511 5:359172-359194 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518526 5:359234-359256 TTCCTCAGTCGCTGACTGCCCGG - Intronic
985518556 5:359358-359380 TTCCTCAGTCGCTGACTGCCCGG - Intronic
986363115 5:7001399-7001421 TTCCAAAGTGAAAGAGTGGCTGG - Intergenic
987821598 5:22972493-22972515 TGCCTCAGCTCCTGAGTGGCTGG + Intergenic
988286362 5:29222774-29222796 TTCCTCAGTGTCTGTTTTGCAGG - Intergenic
992219304 5:74556084-74556106 CTCCTCAGGGACTGTCTGGCAGG - Intergenic
992835279 5:80635102-80635124 CTCCTAAGTGACTAAGGGGCAGG - Intronic
993940277 5:94049705-94049727 TGCCTCAGTCTCTGAGTAGCTGG - Intronic
996544572 5:124664571-124664593 TTCCTCAGAGCCTGTGTGTCAGG + Intronic
997384648 5:133463124-133463146 ATCCTTAGTGACTGTGTGTCAGG + Intronic
997550336 5:134746972-134746994 TGCCTCAGACACTGAGTAGCTGG - Intronic
997708143 5:135978101-135978123 TGCCTAAGTCACTGAGGGGCTGG - Intergenic
998842641 5:146272139-146272161 TTACTGAATGAATGAGTGGCTGG - Intronic
999443982 5:151624178-151624200 TTCCCCAGCGACTGCATGGCTGG - Intergenic
999680980 5:154059883-154059905 CTCCACAGTGACAGAGTGACTGG + Intronic
1002176072 5:177402236-177402258 TTCCGCAGTGAGAGAGTGGCTGG - Exonic
1002310502 5:178310888-178310910 TTCCTGAGTGTCTGAGTCTCAGG - Intronic
1002590399 5:180287479-180287501 TTCAACAGTGACTGACTGCCTGG + Intronic
1002795849 6:470631-470653 TTCCTCAGTGGCTGAGGGACAGG + Intergenic
1003077159 6:2992601-2992623 TGGCACAGTGACTGAGTGGTGGG - Intronic
1003229831 6:4242025-4242047 TTCCTCAGCCTCTGAGTAGCTGG + Intergenic
1006294310 6:33163196-33163218 TTCCTCAGTGACTGTGTGTAGGG - Exonic
1006638498 6:35476379-35476401 TGCCTCTGTGCCTGTGTGGCAGG - Exonic
1007041689 6:38727849-38727871 TTTTCCAGTGACTGGGTGGCAGG + Intronic
1007512681 6:42386327-42386349 TGCCTCAGTCCCTGAGTAGCTGG - Intronic
1008382791 6:50852729-50852751 TTCCTCAGGGCCTGAGAAGCAGG - Intergenic
1010196580 6:73245764-73245786 TTCTTCAGTGATTGGGTGGTGGG - Intronic
1011275917 6:85631226-85631248 TGCCTCAGCCACTGAGTAGCTGG - Intronic
1011513967 6:88131948-88131970 TGCCTCAGCCTCTGAGTGGCTGG - Intergenic
1011595791 6:89014552-89014574 TGCCTCAGTCCCTGAGTAGCTGG - Intergenic
1011863015 6:91784620-91784642 TTCATCAGTGGCTGAGTGCAGGG + Intergenic
1012193181 6:96306386-96306408 TGCCTCAGTCTCTGAGTAGCTGG + Intergenic
1012235568 6:96810379-96810401 TGCCTCAGCTACTGAGTAGCTGG - Intronic
1012509732 6:99989494-99989516 TTCCTCTGTAAGTGAGTGGTAGG + Intronic
1013410529 6:109879738-109879760 TTCCTCCGTGGCTAAGTGTCCGG + Intergenic
1013492690 6:110664596-110664618 TTCCTCAGTGAATGAGTATTAGG - Intronic
1013664985 6:112338602-112338624 TTCCTCAGTGTCTGAGACACAGG + Intergenic
1015850306 6:137565266-137565288 TTCCTCAGCCTCTGAGTAGCTGG + Intergenic
1017015942 6:150099555-150099577 TTCCTGAGTGGCTCAGTGTCTGG - Intergenic
1018608594 6:165624566-165624588 AGCCTCAGTGACTTAGGGGCTGG - Intronic
1019109560 6:169698972-169698994 TTGCTGAGTGACTGAGTGATGGG + Intronic
1019132261 6:169885752-169885774 TTCATCAATAACTGAGAGGCAGG + Intergenic
1019217658 6:170454040-170454062 TTCCTCAGTGCCTGGCTGGTGGG - Intergenic
1019514256 7:1432844-1432866 TTCCTCAGGCACTGGGTGCCTGG - Intronic
1019794304 7:3038500-3038522 TTCCTCAGTTGCAGAGGGGCAGG + Intronic
1019948899 7:4354885-4354907 TGCCTGAGTGTCTGAGTGGGTGG + Intergenic
1019998849 7:4743103-4743125 ATCCTAAGTGACTGAGAGCCTGG + Intronic
1021951051 7:25775458-25775480 TCAGTCAGTGAGTGAGTGGCGGG - Intergenic
1022304289 7:29131937-29131959 TTATTCAGTGAATGAGTGGATGG - Intronic
1023118549 7:36886138-36886160 TTCTTCAGTGGCTGAATGGGAGG + Intronic
1023391078 7:39712295-39712317 TTACTCATTGACTGAGAGACTGG + Intergenic
1024118736 7:46216493-46216515 TTCCTCAGTCACTGAATGGCTGG + Intergenic
1024795571 7:53015535-53015557 TTCCTCAGTCTCTAACTGGCTGG - Intergenic
1024838304 7:53551522-53551544 TTCCTCAGGGAGCGAGTCGCAGG - Intergenic
1026150401 7:67783549-67783571 TTCCTCTCTGAATGGGTGGCAGG + Intergenic
1028520973 7:91730469-91730491 TTGCTCAGTAACTTAGCGGCAGG - Intronic
1028581895 7:92417407-92417429 TCCCACAGGGAGTGAGTGGCTGG - Intergenic
1029400384 7:100341462-100341484 TTGCTTAGTAACTGAGAGGCGGG + Intronic
1029635492 7:101780945-101780967 CTCCTGAGTAGCTGAGTGGCTGG - Intergenic
1030557632 7:111047031-111047053 CTCCTCAGCTACTAAGTGGCAGG + Intronic
1031490098 7:122376556-122376578 TTTCTCAGGGACTGAGGGGAGGG + Intronic
1031570545 7:123353972-123353994 TTCCACAGAGACTAAGAGGCAGG + Intergenic
1033576942 7:142694521-142694543 TTCCTAAGTGACTAAGAGTCTGG - Intergenic
1034055522 7:148031154-148031176 TTCCACAGAGACTGAGAGACTGG + Intronic
1035531552 8:356186-356208 CTCCACAGTGACTGAGGTGCAGG - Intergenic
1039018896 8:33183772-33183794 TCACTCAGTGAGTTAGTGGCTGG + Intergenic
1039142935 8:34413680-34413702 TGCCTCAGCCTCTGAGTGGCTGG + Intergenic
1039350931 8:36762687-36762709 CTTCTCTGTGACTGACTGGCAGG - Intergenic
1039536477 8:38319224-38319246 TTCCTCAGTGTCTGGAAGGCAGG + Intronic
1039894995 8:41710754-41710776 TTCCACAGTAAGAGAGTGGCTGG - Intronic
1040982463 8:53257655-53257677 CTCCTCAGTCCCTGAATGGCTGG + Intergenic
1041358262 8:57022526-57022548 TCCCTCCCTGACGGAGTGGCTGG - Intergenic
1042485099 8:69339243-69339265 TCCCACAGTGCCTGAGGGGCTGG - Intergenic
1045265430 8:100614763-100614785 TTCCTCAGCTCCTGAGTAGCTGG - Intronic
1046445622 8:114314192-114314214 TTCCACAATGGCTGACTGGCAGG + Intergenic
1047751493 8:127884144-127884166 CTCCTGAGTGACTGACTGGGAGG - Intergenic
1048347860 8:133591208-133591230 TTCCTCAGTTGCAGGGTGGCAGG + Intergenic
1049408288 8:142461301-142461323 TGCCTCAGTGACAGAGTGCCTGG + Intronic
1049521054 8:143091661-143091683 TGCCTGAGTGCCTGAGTGCCGGG + Intergenic
1049888653 9:46753-46775 TTAGTCAGTGACTGAGTGAGCGG - Intergenic
1050042584 9:1511739-1511761 TGCCTCAGCCTCTGAGTGGCTGG + Intergenic
1052876701 9:33573480-33573502 TTCCTGAGTGTCAGAGTGGGAGG - Intergenic
1053361274 9:37488344-37488366 CTGCTGATTGACTGAGTGGCTGG + Intronic
1053499300 9:38570907-38570929 TTCCTGAGTGTCAGAGTGGGAGG + Intronic
1053661920 9:40290400-40290422 TTCCTGAGTGTCAGAGTGGGAGG - Intronic
1053912370 9:42920563-42920585 TTCCTGAGTGTCAGAGTGGGAGG - Intergenic
1054374046 9:64436636-64436658 TTCCTGAGTGTCAGAGTGGGAGG - Intergenic
1054522689 9:66085884-66085906 TTCCTGAGTGTCAGAGTGGGAGG + Intergenic
1056602711 9:88058910-88058932 TTCCCTAGTTCCTGAGTGGCAGG - Intergenic
1056688303 9:88784586-88784608 GTCCTCAGTGACTGCGGGTCAGG + Intergenic
1057162361 9:92897241-92897263 TTCCTGAGTGTCAGAGTGGGAGG + Intergenic
1057182174 9:93036134-93036156 TACCCCAGCCACTGAGTGGCAGG + Exonic
1057678718 9:97155389-97155411 TTCCTGAGTGTCAGAGTGGGAGG + Intergenic
1058056883 9:100457685-100457707 TTTCTCAATGCCTGAGTGACTGG - Intronic
1058878049 9:109261102-109261124 TTGCTAAGTGGGTGAGTGGCCGG + Intronic
1058975739 9:110124027-110124049 TTCCTCAATGACTGACTTGGTGG - Intronic
1060052562 9:120387642-120387664 TTCTTCACTGTCTCAGTGGCTGG - Intergenic
1060187799 9:121574637-121574659 TTCCTCACTCGCTGTGTGGCAGG - Intronic
1060617864 9:125035239-125035261 TTCCTCAGACTCTGAGTAGCTGG - Intronic
1060684326 9:125594525-125594547 TTGATCAGTGACTTTGTGGCAGG - Intronic
1061555978 9:131369311-131369333 TGCCTCAGTCTCTGAGTAGCTGG - Intergenic
1062695348 9:137872952-137872974 TGCCTCAGTCTCTGAGTAGCTGG - Intergenic
1185560932 X:1060195-1060217 TTCCTGAGTGGCTAAGTGTCCGG + Intergenic
1186091999 X:6059748-6059770 TTTCTCAGTAAATAAGTGGCTGG - Intronic
1186872472 X:13786110-13786132 TTCCTGATCGACTGAGTGGTGGG + Intronic
1188494286 X:30767117-30767139 TGCCTCAGCCACTGAGTAGCTGG + Intergenic
1189393013 X:40593131-40593153 TGCCTCAGCCACTGAGTAGCTGG - Intronic
1190407631 X:50103448-50103470 TTGCTCAGTAACTCAGAGGCAGG + Intergenic
1192772197 X:74204565-74204587 TTCTTCCATGACTGATTGGCAGG - Intergenic
1195411132 X:104568356-104568378 TACCTCAGTGACAGAGTCCCTGG + Intronic
1196612046 X:117726626-117726648 TTCTTCAGTGATTGATTAGCAGG + Intergenic
1196652569 X:118183321-118183343 TGCCTCAGTCTCTGAGTAGCTGG - Intergenic
1197728022 X:129788986-129789008 TGCCTCAGTCTCTGAGTAGCTGG - Intronic
1197741795 X:129900633-129900655 TACCTCAGCCTCTGAGTGGCTGG + Intergenic
1197764659 X:130052032-130052054 ATCCACGGTGACTGAGTGTCAGG + Intronic
1198125477 X:133639436-133639458 TTATTCAGTCACTGAGTGTCAGG - Intronic
1198654453 X:138898445-138898467 TGCCTCAGTGAGTGAGTAGAAGG - Intronic
1198655474 X:138909132-138909154 TTCCTCTGTGACTTAGGGACAGG + Intronic
1199111881 X:143945367-143945389 TTTCTGAGTGAGTGAGTGTCAGG + Intergenic
1199263417 X:145801891-145801913 TTCCTAAGTGATTCAGTGGGGGG + Intergenic
1199283022 X:146024134-146024156 TTCCTCAGCTGCTGAGTAGCTGG + Intergenic
1199981360 X:152922302-152922324 TTCCTCAGTGACTGAGTGGCAGG - Intronic
1201059397 Y:10031795-10031817 TGCCTCAGCCACTGAGTAGCAGG - Intergenic
1202268592 Y:23046730-23046752 TGCCTCAGTCTCTGAGTAGCTGG - Intergenic
1202421584 Y:24680474-24680496 TGCCTCAGTCTCTGAGTAGCTGG - Intergenic
1202449202 Y:24989608-24989630 TGCCTCAGTCTCTGAGTAGCTGG + Intergenic