ID: 1199990776

View in Genome Browser
Species Human (GRCh38)
Location X:152986551-152986573
Sequence CAGAGCAAGGAGACTTTGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199990776_1199990789 30 Left 1199990776 X:152986551-152986573 CCCGACAAAGTCTCCTTGCTCTG No data
Right 1199990789 X:152986604-152986626 GTACCTCCTTCCAGACTCCCTGG No data
1199990776_1199990786 8 Left 1199990776 X:152986551-152986573 CCCGACAAAGTCTCCTTGCTCTG No data
Right 1199990786 X:152986582-152986604 GGGAAGCAACTGGTTTCTCCCGG No data
1199990776_1199990785 -2 Left 1199990776 X:152986551-152986573 CCCGACAAAGTCTCCTTGCTCTG No data
Right 1199990785 X:152986572-152986594 TGGGCTGGTGGGGAAGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199990776 Original CRISPR CAGAGCAAGGAGACTTTGTC GGG (reversed) Intergenic
No off target data available for this crispr