ID: 1199991429

View in Genome Browser
Species Human (GRCh38)
Location X:152989735-152989757
Sequence GGACCCTGTGGCCTCCCCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 326}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199991423_1199991429 12 Left 1199991423 X:152989700-152989722 CCCTCATGCAGTGTAGATGATCC 0: 1
1: 0
2: 1
3: 7
4: 80
Right 1199991429 X:152989735-152989757 GGACCCTGTGGCCTCCCCTGCGG 0: 1
1: 0
2: 3
3: 45
4: 326
1199991422_1199991429 13 Left 1199991422 X:152989699-152989721 CCCCTCATGCAGTGTAGATGATC 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1199991429 X:152989735-152989757 GGACCCTGTGGCCTCCCCTGCGG 0: 1
1: 0
2: 3
3: 45
4: 326
1199991427_1199991429 -9 Left 1199991427 X:152989721-152989743 CCTAAAGACAGGCTGGACCCTGT 0: 1
1: 0
2: 0
3: 12
4: 220
Right 1199991429 X:152989735-152989757 GGACCCTGTGGCCTCCCCTGCGG 0: 1
1: 0
2: 3
3: 45
4: 326
1199991420_1199991429 26 Left 1199991420 X:152989686-152989708 CCTTCCTGGGGCTCCCCTCATGC 0: 1
1: 0
2: 4
3: 30
4: 397
Right 1199991429 X:152989735-152989757 GGACCCTGTGGCCTCCCCTGCGG 0: 1
1: 0
2: 3
3: 45
4: 326
1199991424_1199991429 11 Left 1199991424 X:152989701-152989723 CCTCATGCAGTGTAGATGATCCT 0: 1
1: 0
2: 1
3: 3
4: 107
Right 1199991429 X:152989735-152989757 GGACCCTGTGGCCTCCCCTGCGG 0: 1
1: 0
2: 3
3: 45
4: 326
1199991421_1199991429 22 Left 1199991421 X:152989690-152989712 CCTGGGGCTCCCCTCATGCAGTG 0: 1
1: 0
2: 3
3: 30
4: 223
Right 1199991429 X:152989735-152989757 GGACCCTGTGGCCTCCCCTGCGG 0: 1
1: 0
2: 3
3: 45
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199991429 Original CRISPR GGACCCTGTGGCCTCCCCTG CGG Exonic
900279651 1:1858448-1858470 GCATCCTATGGCCTCCCCTCTGG + Intronic
900802724 1:4747348-4747370 GGCCTCTGTTGCCTCTCCTGGGG + Intronic
900964833 1:5950671-5950693 GGCTCCTGTGGCCTCTCCTGTGG - Intronic
901019542 1:6248912-6248934 GGAGCCATTGGCCTCCCCAGGGG - Exonic
901469637 1:9447401-9447423 GGAACCTGTGACCGCCCCTAGGG + Intergenic
902099223 1:13971926-13971948 GTTCCCTGAGGCCTCCCCAGAGG + Intergenic
902805258 1:18857314-18857336 GGGCCCAGGGGCCTCACCTGTGG + Exonic
904411153 1:30325646-30325668 AGTGCCTGTGGACTCCCCTGGGG + Intergenic
904675219 1:32195055-32195077 GGCCCCTCTGGCCTCCTCTCAGG - Exonic
905370809 1:37481873-37481895 GGCACCTCTGGCTTCCCCTGTGG - Intronic
906217569 1:44052462-44052484 GGCCCCTGAGGTCTCCCCTTGGG + Intergenic
906667381 1:47631505-47631527 CGCCCCTCTGTCCTCCCCTGGGG + Intergenic
908355786 1:63323863-63323885 GGACCCTACGGCCGCCCCTACGG + Exonic
909463225 1:75943210-75943232 GCAGCCTGTGGCCTGCCCTTTGG - Intergenic
909648724 1:77949168-77949190 GGATGCTGTGGCATTCCCTGGGG + Exonic
912710224 1:111944577-111944599 GGACCCTGGGGCCTCCCAGCAGG + Intronic
914879763 1:151538279-151538301 AGTCCCTGTGGCCTTCCTTGGGG + Exonic
914917150 1:151825871-151825893 GGACCCTGTCGTCACCCCTCTGG - Intronic
915108249 1:153547441-153547463 CACCCCTGTGGCCTCCCTTGTGG - Exonic
916599279 1:166276350-166276372 GGACACTGTGGCATCACCTTTGG + Intergenic
922618087 1:226974788-226974810 GGGGCCTGAGGCCTCCTCTGTGG + Intronic
923273587 1:232378588-232378610 GGAGCCTGAGGCCTCACCTGAGG + Intergenic
923377313 1:233377547-233377569 GAACCCTGTGCTCTTCCCTGTGG - Intronic
924216977 1:241832381-241832403 TGCCCCTGTGGCCTCCAGTGAGG - Intergenic
1062782888 10:232560-232582 GGCCTCTGTGGCCTTCCCTTGGG + Intronic
1062913666 10:1231093-1231115 AGACCCCGTGGTCTCCCCAGGGG - Intronic
1062948033 10:1475438-1475460 GGCCCCAGCGGCCTCCTCTGTGG + Intronic
1065086910 10:22187633-22187655 GGACCCTGGTACTTCCCCTGAGG + Intergenic
1065755385 10:28925658-28925680 GGACCCTGTCACCTGCCCTGAGG + Intergenic
1066351555 10:34641643-34641665 GAACTATGTTGCCTCCCCTGCGG - Intronic
1067690887 10:48501411-48501433 GGCCCCTGAGGCCTCCCCATGGG + Intronic
1067831311 10:49612581-49612603 GGACCCTGAGTCCCCACCTGCGG + Exonic
1070808786 10:79286857-79286879 GGCCCCTGGGGCCTCCCATGGGG + Intronic
1073123557 10:101136132-101136154 GGACCCACTGGCTTCCTCTGAGG - Intronic
1073323908 10:102631638-102631660 GCACCCTGTGGGCACTCCTGTGG - Exonic
1076191638 10:128487455-128487477 GGACCCTATGGCCTTCTCAGAGG + Intergenic
1076614490 10:131746780-131746802 GGACCATGTGCCCACCACTGGGG + Intergenic
1076787075 10:132755788-132755810 GGCCCCTGGAGCCTCCTCTGGGG - Intronic
1076837895 10:133030241-133030263 GGACCCCGGCGCCTCCCCCGTGG - Intergenic
1076905088 10:133357534-133357556 GGACCCGGCCGCCTCCCCAGGGG + Intronic
1077019975 11:413024-413046 TGACCCTGTGGCATCCAGTGAGG - Intronic
1077061394 11:619271-619293 GAACCCTGGGGGCTCACCTGTGG + Intronic
1077162922 11:1121794-1121816 TCACACTGTGACCTCCCCTGGGG + Intergenic
1077269143 11:1666859-1666881 GGACCCCGGGGCCTCCCGGGCGG - Intergenic
1077271404 11:1683855-1683877 GGACCCCGGGGCCTCCCGGGCGG + Intergenic
1077585285 11:3446860-3446882 AGACGCTGTGGCCAGCCCTGAGG + Intergenic
1078083814 11:8221856-8221878 GGCCCCTGTGGCCTCTTCTTGGG + Intergenic
1081988488 11:47324725-47324747 CGTCACTGTGCCCTCCCCTGGGG - Intronic
1082009016 11:47438061-47438083 GGGCCCTGTCCACTCCCCTGAGG + Intronic
1083152008 11:60797906-60797928 GGGCCCTGTGCCCTCCCCATCGG + Intronic
1084242188 11:67829423-67829445 AGACACTGTGGCCAGCCCTGAGG + Intergenic
1084705410 11:70813450-70813472 GGCCCCTGTGGCCATCCCAGGGG + Intronic
1084752616 11:71214158-71214180 AAACCCTGGGGCTTCCCCTGTGG + Intronic
1085028853 11:73257705-73257727 TGTCCCTGTGGCCTCCTCTCAGG - Intergenic
1085391935 11:76186666-76186688 GGACCCCCTGGCCCACCCTGGGG - Exonic
1089171143 11:116512437-116512459 GGAGCCTTTGGCTTCCTCTGTGG - Intergenic
1089402203 11:118170858-118170880 GGAGCCTCTGGCCTGGCCTGAGG + Intronic
1089740374 11:120578167-120578189 GGCACCTGTTGCCTCCCCTGGGG + Intronic
1090203685 11:124873350-124873372 GCTCCATGTGGCTTCCCCTGTGG - Exonic
1090667500 11:128924573-128924595 AGTCCCTGTGGCCTCCCCAGGGG - Intergenic
1091209307 11:133842973-133842995 GGAAGCTGTGGGGTCCCCTGGGG + Intronic
1091887593 12:4027802-4027824 GGTCCCTGTGGCTCCCCATGTGG - Intergenic
1092672746 12:10882404-10882426 GGTCCTTGTGGCCTTCCTTGAGG + Exonic
1092672764 12:10882455-10882477 GGTCCTTGTGGCTTTCCCTGAGG + Exonic
1092672780 12:10882518-10882540 GGTCCTTGTGGCTTTCCCTGAGG + Exonic
1092676930 12:10930820-10930842 GGTCCTTGTGGCTTTCCCTGAGG - Exonic
1092676948 12:10930871-10930893 GGTCCTTGTGGCCTTCCTTGAGG - Exonic
1096217903 12:49808683-49808705 GGTCCCTGCTGCCTCCCCAGGGG + Intronic
1096257926 12:50074112-50074134 GGGCCCTGAGGCCTTCTCTGGGG + Intronic
1096465777 12:51847305-51847327 GGGCCGTGGGGCCTCCCCTGTGG - Intergenic
1096606084 12:52767523-52767545 GGCCACTGTGGCCTTCCCTATGG - Intergenic
1096631120 12:52927361-52927383 CCACCCTTGGGCCTCCCCTGGGG + Intronic
1096741220 12:53695554-53695576 GGCCCCTGCGGCCTCCCGGGAGG + Intergenic
1097051207 12:56224380-56224402 GGAGCCTGTGGCTCCCCCTGCGG + Exonic
1098357772 12:69627393-69627415 GGACCCCGTGACCTGTCCTGAGG + Intergenic
1102258765 12:111430852-111430874 GGACCCTGGGGACCCACCTGTGG - Intronic
1103369433 12:120407745-120407767 GGACCATATGGCCTCCACTGTGG + Intergenic
1103480359 12:121246664-121246686 CCACCCTGCCGCCTCCCCTGTGG + Intronic
1103613602 12:122138622-122138644 GGACCCTGTGGCCTCATCACTGG + Intronic
1104628297 12:130377735-130377757 TGGCCCTGTGGCCTCAGCTGTGG + Intergenic
1104652804 12:130548823-130548845 GGAGGCTGAGGCCTCCCATGGGG - Intronic
1104748021 12:131221950-131221972 GGACACCGTGGCCTCCCCATGGG - Intergenic
1104763101 12:131309835-131309857 AGACTCTCAGGCCTCCCCTGGGG + Intergenic
1104773808 12:131381029-131381051 GGAGCCTGTGTCCTCCCCTGGGG - Intergenic
1104965489 12:132507138-132507160 GGACACTGTGGCCCTCCGTGGGG + Intronic
1104973496 12:132541833-132541855 GGGCCCCGTGCCCTGCCCTGTGG - Intronic
1105071476 12:133236357-133236379 GGACCCAGGCGCGTCCCCTGGGG - Intergenic
1107508794 13:41061297-41061319 CGTCTCTGTGTCCTCCCCTGGGG - Exonic
1108680761 13:52778373-52778395 GGCCTCTGTAGCCTCACCTGTGG + Intergenic
1112234326 13:97621832-97621854 GTAGCCTGGGGCCTGCCCTGGGG + Intergenic
1113664377 13:112131283-112131305 GGACCCCGTGGGATCCTCTGGGG - Intergenic
1113834050 13:113317205-113317227 GGACCCTCAGGTCTCCCCAGAGG + Intronic
1113957938 13:114109109-114109131 GGACCCTGCCGCCTGCCCTCTGG - Intronic
1114531061 14:23396783-23396805 GAACCCAGTGGCCATCCCTGAGG - Exonic
1117189754 14:53278298-53278320 GGTCCCTGGGCTCTCCCCTGGGG + Intergenic
1118612542 14:67552864-67552886 AGAGCCTGGGGTCTCCCCTGGGG - Intronic
1118722428 14:68603991-68604013 GGCCGCTGTGGCCTCCACTGTGG - Intronic
1120948940 14:90023177-90023199 GGACCATGTGGTCTGCCCGGGGG + Intronic
1121553691 14:94820620-94820642 CCACCCTGTGGCTTGCCCTGGGG - Intergenic
1122194766 14:100076713-100076735 GCACTCTGTGGCCTCTGCTGTGG - Intronic
1122243006 14:100381644-100381666 GGCCCCTGTGGCCTCTCAGGTGG - Exonic
1122313746 14:100813506-100813528 GCACCCTGTGGCCCTCACTGTGG + Intergenic
1122790475 14:104182246-104182268 TGACCCTGTGGCCTGACCTGGGG - Intergenic
1122929199 14:104925747-104925769 GCACCCTGAGGTCTCCTCTGTGG + Intronic
1122987552 14:105219508-105219530 GGAACCTGTGGCCTGCACTCTGG - Intronic
1123111457 14:105869392-105869414 GGACCATGTGGCCTCAACAGAGG - Intergenic
1124011756 15:25844767-25844789 GGACCCTGTGGCTTGCCGTCTGG + Intronic
1124239764 15:28019657-28019679 CGGCCCTCTGGCCTGCCCTGTGG - Intronic
1124619571 15:31266058-31266080 TGACCCCGTGGCCTCCTCTGAGG - Intergenic
1124657594 15:31521813-31521835 GGACCCTCTGGCAGCCCCCGGGG - Intronic
1125613276 15:40987285-40987307 GAAACCAGAGGCCTCCCCTGAGG - Intronic
1127838909 15:62812830-62812852 GGACCTCTTGGCCTCCCCTCAGG - Intronic
1127845454 15:62866535-62866557 GGAGCCTGTGGCTTCCCCGGGGG - Intergenic
1128541575 15:68538424-68538446 GGAACCTCTGGCCTCAGCTGCGG + Intergenic
1131272258 15:90954692-90954714 GTCCTCTGTGGCCTCCGCTGAGG + Intergenic
1132286653 15:100668456-100668478 GCCCCCTGTGGCCTGCCCTCGGG + Intergenic
1132584933 16:701983-702005 GGCCTCTGTGTCCTCCCCAGGGG + Intronic
1132600169 16:769611-769633 GCAGCCTGTGGGCCCCCCTGGGG - Exonic
1132676849 16:1124525-1124547 GGACCCGGGGGCTTCCCCTCGGG + Intergenic
1132803717 16:1766265-1766287 GGCCTCTGTGGCCTCCTCTGTGG - Exonic
1132806993 16:1779437-1779459 GTCCCCTGTGGCTTCTCCTGGGG - Intronic
1133039913 16:3055182-3055204 GGCCCCTGTGGACTGCCCTCTGG + Intronic
1133353702 16:5120357-5120379 GGACACTGTGGCCAGCCCTGAGG + Intergenic
1133996626 16:10753367-10753389 TGCCCTTGTGGTCTCCCCTGGGG + Intronic
1134416584 16:14048545-14048567 GGCCCCTGTGTCTTCCTCTGTGG - Intergenic
1134441222 16:14300923-14300945 GGTCCCTGGGACCTCCTCTGTGG + Intergenic
1136288468 16:29257924-29257946 TGGCCCCGTGGCCTCTCCTGTGG + Intergenic
1136615859 16:31397988-31398010 GGCCCCTGTGCCCTCCCTGGAGG + Intronic
1137396343 16:48118180-48118202 GGCCCCAAAGGCCTCCCCTGGGG - Intronic
1137614244 16:49837473-49837495 GGCCCCGGTGGCTTTCCCTGGGG + Intronic
1137636703 16:49993049-49993071 GGTCCCTCCGGCCTCCCCTGCGG - Intergenic
1138427887 16:56948424-56948446 AAACCCTGTGGCCTTCCCTGAGG + Intergenic
1139692498 16:68650155-68650177 GGACCCTCAGGCCTGCCCAGGGG - Intronic
1141012774 16:80418402-80418424 GAACTCTGTGGCTTCCACTGGGG - Intergenic
1141151603 16:81568235-81568257 GGACCCTCTGGCCTCACCCTTGG + Intronic
1141513437 16:84527124-84527146 CGAGGCTGTGGCCTCCACTGTGG - Intronic
1142094182 16:88230830-88230852 TGGCCCCGTGGCCTCTCCTGTGG + Intergenic
1142348351 16:89568460-89568482 TGACCCTTCCGCCTCCCCTGCGG - Intergenic
1144854952 17:18262530-18262552 GGCCTCGGTGTCCTCCCCTGTGG + Intronic
1146186730 17:30729103-30729125 GGACCAGGTGTCCTGCCCTGTGG + Intergenic
1146468301 17:33104492-33104514 GGTCCCTGTGACCAACCCTGAGG - Intronic
1147632736 17:41942630-41942652 TGACCCTGCTGCCTTCCCTGAGG - Intronic
1147956437 17:44137990-44138012 GGACCCTGGCACCTCCCCAGGGG + Intergenic
1148119277 17:45198051-45198073 TGGCTCTGTGGCCTCCCCAGAGG + Intergenic
1148154377 17:45414267-45414289 GGCCCCTGTGCCTTCCACTGGGG - Intronic
1151597260 17:75086157-75086179 GGGCCCTGTAGCCACCCCAGGGG + Intergenic
1151725088 17:75878763-75878785 GGACCACGCGGACTCCCCTGGGG - Intergenic
1151765415 17:76131106-76131128 GGTCCCGGCGGCCTCCCATGGGG - Intergenic
1151834171 17:76572554-76572576 GAGCCCTGTGGCCCCCACTGAGG + Intronic
1151950598 17:77351592-77351614 GGGCCCTGGGGCCGCCTCTGAGG - Intronic
1152201103 17:78946786-78946808 GGACCCTGTCACCTCCCCTATGG + Intergenic
1152637975 17:81437941-81437963 GGGCCCTGGGGCCTGCCTTGGGG + Intronic
1152644169 17:81461191-81461213 GCAGCTTGTGGGCTCCCCTGGGG - Exonic
1152681723 17:81671916-81671938 GGCACCTGTGGTTTCCCCTGGGG + Intronic
1152694219 17:81735563-81735585 AGACTCTGGGGCTTCCCCTGTGG + Intergenic
1152873556 17:82772625-82772647 GGACTCTGTGGCTTTCTCTGAGG + Intronic
1152883398 17:82833298-82833320 GGATGCTGCTGCCTCCCCTGGGG + Intronic
1152925699 17:83086865-83086887 GGAGCCTGTGCCCTCACCTTTGG + Intronic
1160683282 19:422328-422350 GGCCCCTGTGGCCCCCACGGAGG - Exonic
1160876828 19:1300353-1300375 GGTCCCTGTGCCCTGGCCTGGGG + Intergenic
1160981461 19:1818415-1818437 GGAACCTGGGCCCTCCCTTGAGG - Intronic
1161056557 19:2193562-2193584 GGAGACTGTGGCCTCCCCTGTGG + Intronic
1161083545 19:2323222-2323244 GGTCCCTGTCTCCTCCCCAGAGG - Intronic
1162514457 19:11139503-11139525 TGACACAGTGGCCTCCACTGGGG + Intronic
1162972170 19:14187389-14187411 GGACCAGGTGTCCTGCCCTGTGG - Intronic
1163256182 19:16157365-16157387 GGACCCTCTGGCCTCTCTCGGGG - Exonic
1163519044 19:17781166-17781188 GGCCTCTGGGGCCTCCCCAGGGG - Intronic
1163784462 19:19267626-19267648 GGACCCTGTGGCCTACCCTAAGG - Exonic
1163820233 19:19492240-19492262 GGACCCAGTGCCCACCCCTGTGG - Intronic
1164618986 19:29682589-29682611 GGAGCCTGTGGCCTGCCACGGGG - Intergenic
1164684173 19:30156249-30156271 GTACTGTGTGGCCTTCCCTGTGG + Intergenic
1164693875 19:30228995-30229017 GGTCCCAGTGGCCGCCGCTGAGG + Intronic
1164776345 19:30856563-30856585 GGACACTGCTGCCTGCCCTGGGG - Intergenic
1165759354 19:38311613-38311635 GGTCCCTGTGGCCTCACGTGGGG + Intronic
1166478644 19:43151268-43151290 GCACCCTGTGGCCTCCACCTAGG - Intronic
1167466819 19:49654542-49654564 GGAGCCTGTTGCCTCAGCTGTGG + Intronic
1168121384 19:54254215-54254237 GGAGCCTGTGGCCCCTCCTCTGG + Intronic
1168124894 19:54277740-54277762 GGACCCTGTGGCCCCTCCTCTGG + Intronic
1168132926 19:54332366-54332388 GGAGCCTGTGGCCCCTCCTCTGG + Intergenic
1168160714 19:54508615-54508637 GGACCCTGTGTTCTGCCCAGTGG - Intronic
1168177092 19:54633809-54633831 GGACCCTGTGGCCCCTCCTCTGG - Intronic
1168291909 19:55361271-55361293 GGTCCTCGTGCCCTCCCCTGGGG - Intronic
1168445034 19:56404313-56404335 GGCCCCTGCGGCCTGCCCTAGGG + Exonic
1168482883 19:56736361-56736383 AGACACTGGGGCTTCCCCTGCGG + Intergenic
925385847 2:3461221-3461243 GGACCCTGCAGCATCCCCAGAGG + Intronic
925890537 2:8430732-8430754 GGACCCTCTGGCTTCCCCTCTGG - Intergenic
925912089 2:8580737-8580759 GGACCGTGGGACCTCCCCTCAGG - Intergenic
931149084 2:59552796-59552818 GGGCCCTGTTGCATCTCCTGTGG + Intergenic
932417632 2:71583445-71583467 GGTCTCTGTGGCCTCCCTGGTGG + Intronic
933030767 2:77326017-77326039 GGATCCTGTGACCTGCTCTGGGG - Intronic
933326857 2:80848850-80848872 GGACTCTGTGGATTCCTCTGTGG + Intergenic
933760000 2:85666553-85666575 GGCCCCTGTGCCCACCCATGGGG - Intronic
934564917 2:95333448-95333470 GGACCCTGACTCCTCTCCTGTGG + Intronic
934670235 2:96208073-96208095 GAACCCTGGGGCCTGCCCTGTGG - Intronic
935363453 2:102267107-102267129 GGACCCTGGTCCCTGCCCTGGGG + Intergenic
936065873 2:109331847-109331869 TGCCCCTGGGGTCTCCCCTGAGG + Intronic
936153679 2:110035198-110035220 GGCCCCTGGGGCCGCCCGTGTGG - Intergenic
936471463 2:112802347-112802369 GGAGGCTGAGGCCTCACCTGAGG + Intergenic
938379238 2:130827337-130827359 GGACCCTGGGGGCTCAGCTGAGG - Intergenic
941806580 2:169716586-169716608 GGTCCCTGGGCTCTCCCCTGGGG + Intronic
945013187 2:205486556-205486578 GCTCCCTGAGGCCTCCCCAGAGG - Intronic
946081827 2:217127009-217127031 TGATCCTGTGGTCACCCCTGTGG - Intergenic
946334892 2:219029955-219029977 GACCCCAGGGGCCTCCCCTGGGG - Intronic
947118729 2:226796870-226796892 GGGCACTGGGGCCACCCCTGGGG + Exonic
947719923 2:232364015-232364037 GGAGCCTGTGGGCTCTCCTGAGG - Intergenic
947724239 2:232387543-232387565 GGCCCCTGGGGCCTCAGCTGCGG + Intergenic
947932832 2:233977648-233977670 AGTTCCTGTGGCCTCCCCCGAGG + Intronic
948286902 2:236793168-236793190 GGCCCCTGTTCCCTCCCCCGGGG + Intergenic
948915734 2:241034349-241034371 GGGCTCTTGGGCCTCCCCTGGGG - Intronic
1168880666 20:1203760-1203782 GGACCCTGCAGTCTCCCCTCTGG + Intronic
1169091859 20:2865732-2865754 GCCCCCTGTGGCCCTCCCTGGGG - Intronic
1170531419 20:17296224-17296246 GGACCCTGTGTCCTGCTCAGAGG - Intronic
1171175916 20:23050598-23050620 GGATCCTGCGCGCTCCCCTGGGG - Intergenic
1171466109 20:25329084-25329106 GGACCCTCTGGCCTCCCACGTGG + Intronic
1172033616 20:31997447-31997469 GGACACTGTAGCCTACACTGTGG - Exonic
1172480775 20:35270152-35270174 TGACCCGATGGCCTCCCATGAGG - Intronic
1173643345 20:44618503-44618525 GGCCTCTGTGGCCTCCACTCCGG + Exonic
1173648081 20:44646074-44646096 GGTCCCTGTGGTACCCCCTGGGG - Intronic
1174482556 20:50841831-50841853 GGACCATGGGGCCTTCCCTCAGG + Exonic
1175310323 20:58007210-58007232 GGCTCCTGGGGCCTCCCTTGTGG + Intergenic
1175697659 20:61114615-61114637 GGATCCTGTGGGTTCCCCAGAGG - Intergenic
1176023612 20:62974871-62974893 GGTCCCTGTGACCCCCCTTGGGG + Intergenic
1176255156 20:64147895-64147917 GGGCCCAGGGGCTTCCCCTGAGG + Intergenic
1179675183 21:42975655-42975677 GGACCCTCGGGCCTCCCGTCAGG - Intronic
1182292997 22:29296300-29296322 GGACACTGTGGCATCGCCTTTGG - Exonic
1182866914 22:33611990-33612012 GCTCCCTGAGGCCTCCCCAGAGG + Intronic
1183299849 22:37053468-37053490 AGGCCCTGTGGCCTCTGCTGTGG + Intronic
1183327795 22:37203834-37203856 GGACACTCTGGCCTGGCCTGTGG - Intergenic
1183380664 22:37489075-37489097 GGGCCCAGGGCCCTCCCCTGTGG - Intergenic
1183477358 22:38042872-38042894 GGGCCCCTTGGCCTCCCCTCCGG - Intergenic
1183494122 22:38132799-38132821 GGACCGCGTGTCCTGCCCTGTGG - Intronic
1183511066 22:38235274-38235296 GGCCCCTGTGGCTTCCCTGGAGG - Intronic
1183618131 22:38957218-38957240 CACCCCTGTGTCCTCCCCTGTGG - Intronic
1184098253 22:42328313-42328335 GCATCCTGTGGGCTCCCCTGAGG + Intronic
1184434542 22:44462412-44462434 GGATTCTGTGGCCTCCTCTCAGG - Intergenic
1185056039 22:48578819-48578841 GGTCCCCCAGGCCTCCCCTGGGG - Intronic
1185097927 22:48821840-48821862 GGTCCCTCTGGCCTGGCCTGGGG + Intronic
1185234388 22:49703615-49703637 AGCCCCTTTGGCCTCCCATGGGG + Intergenic
1185241645 22:49750326-49750348 GGGCCCTGTGCCCTCCCATGGGG + Intergenic
949125991 3:445657-445679 GCTGCCTGAGGCCTCCCCTGAGG - Intergenic
952390592 3:32876261-32876283 CGACACTGTGGCATCGCCTGAGG + Intronic
953631475 3:44621623-44621645 GTTCCCTGAGGCCTCCCCAGAGG + Intronic
954443875 3:50536259-50536281 TGACCCTGTGGGCTCTGCTGGGG - Intergenic
954642620 3:52110614-52110636 GGCCTCTGTGGGCTCTCCTGTGG + Intronic
955613705 3:60783797-60783819 AGAGCCTGTGTGCTCCCCTGTGG - Intronic
955917153 3:63917915-63917937 AAACCTTCTGGCCTCCCCTGGGG - Intronic
957057653 3:75456350-75456372 AGACACTGTGGCCAGCCCTGAGG + Intergenic
961009139 3:123424396-123424418 AGACCTTGGGGCCTCCCCAGGGG + Intronic
961295802 3:125883380-125883402 AGACACTGTGGCCAGCCCTGAGG - Intergenic
961506308 3:127372487-127372509 CGGCCCTGTGGCCTCCTCTCGGG + Intergenic
961809459 3:129513617-129513639 TTACCCTGTGCCATCCCCTGGGG + Intronic
962273012 3:133991941-133991963 GTTTCCTGTGGCCTCCACTGAGG - Intronic
967078305 3:186025267-186025289 GGCCACCGTGGCCTCCTCTGAGG + Intergenic
967443804 3:189540808-189540830 GCATCCTGAGGCCTCCCCAGAGG + Intergenic
967565558 3:190967200-190967222 GTTCCCTGAGGCCTCCCCAGAGG - Intergenic
968089638 3:195892257-195892279 GGGCCAAGTGGCCTCTCCTGCGG - Intronic
968573269 4:1353504-1353526 GGATGCAGGGGCCTCCCCTGGGG + Intronic
968595614 4:1480907-1480929 CCACCCTGTGGCCAGCCCTGGGG - Intergenic
968876240 4:3269317-3269339 GGACCCTGTGTCCTCCTGGGTGG - Intronic
969151015 4:5168471-5168493 GGCTCCTGTGGGTTCCCCTGTGG + Intronic
969695641 4:8732778-8732800 GATCCCTGTGGCCTCCCCTTGGG - Intergenic
969753541 4:9131905-9131927 AGACACTGTGGCCAGCCCTGAGG - Intergenic
972368009 4:38393894-38393916 GCTCCCTGAGGCCTCCCCAGAGG + Intergenic
975529375 4:75385167-75385189 GGATCCTGTGGTCTTGCCTGTGG - Intergenic
975529528 4:75386113-75386135 GGGCCCTGTGGTCTTGCCTGTGG - Intergenic
976087154 4:81418244-81418266 GGACCGTGTGGGCACCCTTGTGG - Intergenic
976423837 4:84877227-84877249 GCACCCTGAGCCCTCTCCTGGGG + Intronic
977437679 4:97020024-97020046 GCAGCCTGTGGCCTTCCCAGAGG - Intergenic
979212339 4:118120295-118120317 CGACCCTGGTGCTTCCCCTGTGG - Intronic
980044449 4:127972343-127972365 GGACCCTCTGACCTCCACAGAGG - Intronic
984316394 4:178137351-178137373 GGTCCCTGAGCCCGCCCCTGGGG - Intergenic
984841319 4:184070284-184070306 GTTCCCTGAGGCCTCCTCTGAGG + Intergenic
984866878 4:184288513-184288535 GGAACCTGTGCCCTCCCATGCGG - Intergenic
985171006 4:187150243-187150265 GTTCCCTGTGGCCTCACCAGAGG - Intergenic
985622066 5:960984-961006 AGATCCTGTGGCCTCCCTGGAGG - Intergenic
985622222 5:961648-961670 GGACCCTGTGGCTTCCCTCTGGG - Intergenic
985669568 5:1200570-1200592 GGACCCCGTGGTCAGCCCTGTGG + Intergenic
986574655 5:9199288-9199310 GTCCCCTGTGCCATCCCCTGGGG + Intronic
989565176 5:42894477-42894499 GGACCCTCTTGCCGTCCCTGCGG + Intergenic
990960714 5:61391073-61391095 TGCCCCTGTGGCCTTACCTGTGG - Intronic
997965463 5:138352801-138352823 GGACGCGGCGGCCTCCCCGGTGG + Exonic
1000252204 5:159506394-159506416 CCACCCAGTGGCCTGCCCTGTGG + Intergenic
1002296265 5:178232852-178232874 GGCCCCTGCGGCCTCCCTTCCGG + Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002901115 6:1410434-1410456 GGACCCTGTTGTCTAACCTGGGG + Intergenic
1003106113 6:3217321-3217343 GGATACTGTGTCCTCCCCTGAGG - Intergenic
1003505566 6:6737406-6737428 AGCCCCTGTGTCCTGCCCTGAGG - Intergenic
1003507429 6:6751393-6751415 GGACACTGTGGCCCCTCCTCTGG - Intergenic
1006239165 6:32662232-32662254 GGTCACTGTGGGCTCCACTGAGG + Exonic
1006248304 6:32759115-32759137 GGTCACTGTGGGCTCCACTGAGG + Exonic
1006396544 6:33791048-33791070 GAACCCTGTTGTCTTCCCTGTGG + Intergenic
1006561020 6:34912487-34912509 GGACCGTGTGGCCTGCCCAGAGG + Intronic
1007115882 6:39343042-39343064 GGGCCCTGGGGCTTGCCCTGTGG + Intronic
1007309086 6:40930908-40930930 GGGACCTGTGGGGTCCCCTGTGG + Intergenic
1007785976 6:44279554-44279576 AGACCCAGTGGACTCCTCTGGGG - Exonic
1007952489 6:45884771-45884793 AGACCATGTGGCCTCCCATGTGG + Intergenic
1008285183 6:49640616-49640638 TGGCCCTGTGCCCTCCCCTAGGG + Intergenic
1011283878 6:85704117-85704139 GCACCCTGAGGCCTCCCCAGGGG + Intergenic
1018028062 6:159821060-159821082 GGACACTGTGTCCTCCACAGTGG + Intergenic
1018628905 6:165805450-165805472 GGCCCCTTTGTCCTCCACTGGGG - Intronic
1018686240 6:166307158-166307180 GGAGCCTGCGGTCTCCCCCGAGG + Exonic
1018918994 6:168157877-168157899 GGACCCTGGGCCCTTCTCTGGGG - Intergenic
1019341310 7:510346-510368 GCACCTTGTGGCCTCCCAGGAGG + Intronic
1019415119 7:923570-923592 AGACCCTCTGCCCTCCCCTGCGG + Intronic
1020746985 7:12090934-12090956 GGGCCCTGGGCTCTCCCCTGGGG - Intergenic
1022907822 7:34873495-34873517 GCTCCCTGAGGCCTCCCCAGAGG - Intronic
1023243811 7:38178715-38178737 GGACCCTGAGGAGTCCCCGGTGG + Intronic
1023794362 7:43779638-43779660 GGCCCCTGTGGCTCACCCTGTGG + Intronic
1025007118 7:55363538-55363560 GCACCCGGTGGCCTCCCCGGAGG + Intergenic
1026141964 7:67714128-67714150 GGACCCTGTGAGGTTCCCTGGGG + Intergenic
1026773020 7:73213952-73213974 GGACCCTGAGGCCTCGGCAGAGG - Intergenic
1027013882 7:74767348-74767370 GGACCCTGAGGCCTCGGCAGAGG - Intergenic
1027074155 7:75178684-75178706 GGACCCTGAGGCCTCGGCAGAGG + Intergenic
1029493465 7:100884649-100884671 TGAACCTGTGGCCTCAGCTGTGG + Intronic
1030315458 7:108109729-108109751 GGGACCTGTGGGCTCCTCTGTGG + Intronic
1034270877 7:149802979-149803001 GGACCCTGCAGCGTCTCCTGCGG + Intergenic
1034986896 7:155521896-155521918 GCAACCTGTGCCCTGCCCTGCGG + Intronic
1035451686 7:158980886-158980908 GGACACTGTGGCCTTGCCTGCGG - Intergenic
1036200923 8:6771208-6771230 TCCCCCTGTGGCCTCCCATGGGG + Intergenic
1036294542 8:7525406-7525428 GGATCCTATGGCCTCCACTGTGG - Intergenic
1036296185 8:7540063-7540085 GCATCCTGTGGCCTCCACTGTGG - Intronic
1036326381 8:7780956-7780978 GCATCCTGTGGCCTCCACTGTGG + Intronic
1036328020 8:7795585-7795607 GGATCCTATGGCCTCCACTGTGG + Intergenic
1036376761 8:8207238-8207260 AGACACTGTGGCCAGCCCTGAGG - Intergenic
1036852774 8:12215900-12215922 AGACACTGTGGCCAGCCCTGAGG + Intergenic
1036874145 8:12458422-12458444 AGACACTGTGGCCAGCCCTGAGG + Intergenic
1037923734 8:22828621-22828643 GCACCCTGTTGCCTTCTCTGTGG + Intronic
1037957852 8:23072623-23072645 GGGCCCTGTGGACTCTGCTGAGG - Intergenic
1038245359 8:25849939-25849961 GCACCATGTGGTATCCCCTGGGG + Intronic
1038658174 8:29473203-29473225 GGCACCTGTGGCCTCCTCAGTGG + Intergenic
1039722089 8:40175092-40175114 TGACCTTGTGTCCTGCCCTGAGG + Intergenic
1039913307 8:41841859-41841881 GGACCCTGAGGCACCTCCTGGGG + Intronic
1040318419 8:46276966-46276988 CAACCCTGTGGGCTCCTCTGGGG + Intergenic
1040547087 8:48407177-48407199 GGACCCTGAGGGCTCCTCTCAGG + Intergenic
1042866337 8:73359688-73359710 GGACCCAGTGCCCACCCGTGAGG + Intergenic
1043369193 8:79571564-79571586 TGACCGTGTGGCCTTCTCTGGGG - Intergenic
1043943562 8:86224688-86224710 GCACCCTGTGCCCTGCCCAGTGG + Intronic
1044648940 8:94474713-94474735 GGCCCCTGGGGCCGCCACTGCGG - Intronic
1044873928 8:96645585-96645607 GGAGCCTGTGGCTGCCCCTTCGG + Intronic
1047249498 8:123171019-123171041 GGAGCCTCTGTCCTCCCCAGAGG - Intergenic
1049203191 8:141351707-141351729 GGGCCTTGTGGCCTGTCCTGGGG + Intergenic
1049248831 8:141577418-141577440 GGACCCTGTGGCCAACCGAGGGG - Intergenic
1049408084 8:142460555-142460577 GGCCCCTGTGGTCCCTCCTGTGG + Intronic
1049496688 8:142938958-142938980 GGGGCCTGTGGGCGCCCCTGAGG + Intergenic
1049539462 8:143201380-143201402 GGCCCCTGAGTCCTCCCCTGCGG + Intergenic
1049551703 8:143263028-143263050 GAACCCCGGGGCCTCCTCTGGGG - Intronic
1049607694 8:143537341-143537363 GGGCTCTGTGGCCTCCCTTGCGG - Intronic
1050652661 9:7790528-7790550 GGTCCCTGGGCTCTCCCCTGGGG + Intergenic
1052836004 9:33250581-33250603 GGACTCTGTGGCCCCCTCTCTGG + Intronic
1053279152 9:36806126-36806148 CGGCCCTGTGGCCTCCTGTGGGG - Intergenic
1057271028 9:93651588-93651610 GGTCACTGTGGGCCCCCCTGAGG - Intronic
1057858648 9:98622696-98622718 GCCCCATGTGGCCTGCCCTGGGG + Intronic
1061147382 9:128807969-128807991 CGATCCTGTGGCTTCCCCTCAGG - Exonic
1061424403 9:130490034-130490056 AGGCCCTGTGGCCACCCCAGTGG - Intronic
1061578807 9:131524217-131524239 GCACCTTGGGGGCTCCCCTGAGG + Exonic
1061926131 9:133806912-133806934 GGACCCCCTCGCCTGCCCTGCGG - Intronic
1062047451 9:134431087-134431109 GGAGCCTGGGCTCTCCCCTGTGG - Intronic
1062070043 9:134550422-134550444 GGACCCTCTTGCTTTCCCTGGGG + Intergenic
1062117621 9:134817872-134817894 CCACCCTCTGGGCTCCCCTGGGG - Intronic
1062141033 9:134959332-134959354 GGAGCCTGTGTGCTGCCCTGGGG + Intergenic
1062249251 9:135586080-135586102 GGATCCTGTGGCTTCCCGTGTGG - Intergenic
1062320365 9:135987926-135987948 GGATCCTGTGGGCTCCCAGGGGG - Intergenic
1203665882 Un_KI270754v1:20459-20481 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1203667031 Un_KI270754v1:26098-26120 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1203668179 Un_KI270754v1:31737-31759 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1187174413 X:16883029-16883051 GGAACCTGTGGCTCCCCCTGTGG - Intergenic
1187503844 X:19863059-19863081 GGACCCTGTCCCCTCCCTGGGGG + Intronic
1188370957 X:29369150-29369172 GAACCCTGTGGCCTTGGCTGTGG + Intronic
1190240305 X:48653110-48653132 TGACCCTGGTGCCTCCCATGTGG + Intergenic
1190748056 X:53338282-53338304 GGCCCCTCTCCCCTCCCCTGAGG + Intergenic
1190798732 X:53769487-53769509 GGCCCCTCTCCCCTCCCCTGAGG + Intergenic
1192246057 X:69372608-69372630 GGAACTTGTGGCCTGCCCTAGGG + Intergenic
1195321736 X:103726675-103726697 GGACCATGTGGCCTCCCAGCAGG - Intronic
1198963141 X:142203704-142203726 GGACCCTGTGGAGGACCCTGTGG + Exonic
1199991429 X:152989735-152989757 GGACCCTGTGGCCTCCCCTGCGG + Exonic