ID: 1199993384

View in Genome Browser
Species Human (GRCh38)
Location X:153003004-153003026
Sequence CAGTGTTCTGCAGGTTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199993380_1199993384 19 Left 1199993380 X:153002962-153002984 CCTGAGACTAGGTATTTATAAAG No data
Right 1199993384 X:153003004-153003026 CAGTGTTCTGCAGGTTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199993384 Original CRISPR CAGTGTTCTGCAGGTTGTAC AGG Intergenic
No off target data available for this crispr