ID: 1199993621

View in Genome Browser
Species Human (GRCh38)
Location X:153004765-153004787
Sequence ACAGAGTATAAGGGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199993621_1199993628 22 Left 1199993621 X:153004765-153004787 CCTTCTTCACCCTTATACTCTGT No data
Right 1199993628 X:153004810-153004832 GTTGAAACTGCCAAGGCTTATGG No data
1199993621_1199993626 15 Left 1199993621 X:153004765-153004787 CCTTCTTCACCCTTATACTCTGT No data
Right 1199993626 X:153004803-153004825 ACACCATGTTGAAACTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199993621 Original CRISPR ACAGAGTATAAGGGTGAAGA AGG (reversed) Intergenic
No off target data available for this crispr