ID: 1199995269

View in Genome Browser
Species Human (GRCh38)
Location X:153020652-153020674
Sequence CCATTAGGAAATAAGTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199995264_1199995269 13 Left 1199995264 X:153020616-153020638 CCTGTACACTGTTGATGGGGATG No data
Right 1199995269 X:153020652-153020674 CCATTAGGAAATAAGTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199995269 Original CRISPR CCATTAGGAAATAAGTATGG AGG Intergenic
No off target data available for this crispr