ID: 1200000856

View in Genome Browser
Species Human (GRCh38)
Location X:153059065-153059087
Sequence CACTGGGCTCCCGGGGCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 423}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200000856_1200000865 2 Left 1200000856 X:153059065-153059087 CCTAAGGCCCCGGGAGCCCAGTG 0: 1
1: 0
2: 2
3: 36
4: 423
Right 1200000865 X:153059090-153059112 AGCCAGAGGTTGTGCAGGCAAGG 0: 1
1: 0
2: 0
3: 27
4: 271
1200000856_1200000863 -3 Left 1200000856 X:153059065-153059087 CCTAAGGCCCCGGGAGCCCAGTG 0: 1
1: 0
2: 2
3: 36
4: 423
Right 1200000863 X:153059085-153059107 GTGCCAGCCAGAGGTTGTGCAGG 0: 1
1: 0
2: 3
3: 20
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200000856 Original CRISPR CACTGGGCTCCCGGGGCCTT AGG (reversed) Intronic
900115628 1:1026682-1026704 CGCTGGGCTTCGGGGGCCCTGGG - Intronic
900609161 1:3537183-3537205 CACTGGGCTGCCTGGGGCCTTGG - Intronic
900901480 1:5519469-5519491 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
901044115 1:6385421-6385443 GACTGGGCAGCCAGGGCCTTGGG - Intronic
901049031 1:6417065-6417087 CACTGTGCACCCTGTGCCTTGGG + Exonic
901092833 1:6653677-6653699 CACTTGGCTCCCAAGGTCTTGGG - Intronic
901242663 1:7704311-7704333 CGCGGGGCTCCGGGGGCCGTCGG + Intronic
901384950 1:8901949-8901971 CTCTCAGCTCCCTGGGCCTTTGG + Intergenic
901644480 1:10709218-10709240 CCCAGGCCTCCCGGGGCCATGGG + Intronic
901742683 1:11352567-11352589 CAAAGGGATCCCGGGGCATTTGG - Intergenic
901967532 1:12880704-12880726 CACTGGGCTCCTGTGGCCCAGGG - Intronic
901975331 1:12939835-12939857 CACTGGGCTCCTGTGGCCCAGGG - Intronic
902009844 1:13261930-13261952 CACTGGGCTCCTGTGGCCCAGGG + Intronic
902017644 1:13321081-13321103 CACTGGGCTCCTGCGGCCCAGGG + Intronic
902905552 1:19554105-19554127 CAATGAGCTCCAGGGGCATTAGG + Intergenic
903326280 1:22570696-22570718 CACCGGGCTCCCGGGAGCTGGGG + Intronic
903679961 1:25089932-25089954 GACTGGGTTCCGGGAGCCTTAGG - Intergenic
904627416 1:31814829-31814851 CTCTGGCCTCCCTGGGCCTGAGG + Exonic
905635355 1:39547546-39547568 CTCTGGGCTCCCATGGCCTCTGG - Intergenic
906526010 1:46493675-46493697 CAGTGGGCTCCAGTGGCCTCGGG - Intergenic
907044281 1:51290319-51290341 CTCTGGGCTCCCGCAGCCTTGGG - Intronic
907259472 1:53206525-53206547 AAGTGGGCTCCCAAGGCCTTTGG - Intronic
907307656 1:53522336-53522358 CACTGAGCCCCCGGGGACTTGGG - Intronic
907584836 1:55608026-55608048 AACTGGGCTCCTATGGCCTTGGG + Intergenic
908616738 1:65930520-65930542 GGCTGGGCTCCCAAGGCCTTGGG - Intronic
910563496 1:88618232-88618254 GAGTGGGCTCCCAGGGCCATAGG + Intergenic
910724991 1:90328651-90328673 CAGTGAGCTCCCCTGGCCTTGGG - Intergenic
911235180 1:95404557-95404579 GAGTGGGCTCCCAAGGCCTTGGG - Intergenic
912153079 1:106882895-106882917 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
912267657 1:108174733-108174755 AAGTGGGCTCCCATGGCCTTGGG - Intronic
912643991 1:111373273-111373295 CAGTGGTCACCCTGGGCCTTGGG + Intergenic
913396538 1:118377921-118377943 GAGTGGGCTCCCAAGGCCTTGGG - Intergenic
913937200 1:125065769-125065791 CACCGGGGACCCGGGGGCTTGGG + Intergenic
915659475 1:157390628-157390650 CTCTCAGCTCCCTGGGCCTTTGG + Intergenic
916577748 1:166082290-166082312 CACTGGACTTGCTGGGCCTTTGG + Intronic
917152063 1:171956462-171956484 AAGTGGGCTCCCATGGCCTTGGG + Intronic
918668160 1:187178234-187178256 GAGTGGGCTCCCAAGGCCTTGGG + Intergenic
919212906 1:194510940-194510962 TAGTGGGCTCCCATGGCCTTGGG - Intergenic
921157426 1:212449455-212449477 CTCTGAGCTCCTGGGGCCTGGGG + Intergenic
921716083 1:218418229-218418251 AAGTGGGCTCCCATGGCCTTGGG - Intronic
922229576 1:223674067-223674089 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
922542970 1:226433120-226433142 CACTGGGGTCCCGGAGCCTGGGG + Intergenic
923046872 1:230362104-230362126 CACTGGCTTCCCGCGCCCTTGGG - Intronic
923899073 1:238305580-238305602 GAGTGGGCTCCCAAGGCCTTGGG - Intergenic
924698962 1:246430598-246430620 CACTGGGCTTACGGGGCTTGTGG + Intronic
1063593352 10:7411907-7411929 CGCGGAGCTCCCAGGGCCTTAGG + Intergenic
1066695811 10:38076698-38076720 CAATGGGCTCCCGAGGTGTTGGG + Intergenic
1066996726 10:42570865-42570887 CAATGGGCTCCTGAGGTCTTGGG - Intergenic
1067210829 10:44259411-44259433 CACAGGGCTCCTGGGGCCCAGGG + Intergenic
1067732592 10:48822725-48822747 GACTGGGCTCAGGGGGCCTGAGG - Intronic
1068432365 10:56949382-56949404 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
1070965681 10:80528934-80528956 CACAGGGCTCCCCTGGCCTGGGG + Exonic
1071602727 10:86966804-86966826 CACTGGGCTCCAGGCCCCATGGG - Intronic
1071990083 10:91093071-91093093 AAATGGGCTCCCAAGGCCTTGGG + Intergenic
1073510266 10:104038463-104038485 CCCTGGGCCCCCTGGGCCTCCGG - Exonic
1073952652 10:108829005-108829027 CTATGGGCTCCCAAGGCCTTAGG + Intergenic
1075019857 10:118943942-118943964 AGCTGGGCTCCTGGGGCCTGGGG - Intergenic
1075465652 10:122648467-122648489 TCCTGGGCTCCTGGTGCCTTGGG - Intergenic
1076323725 10:129604205-129604227 GAAGGGGCTGCCGGGGCCTTTGG + Intronic
1076392234 10:130111449-130111471 TGCTGAGCTGCCGGGGCCTTTGG + Intergenic
1076463192 10:130660337-130660359 CAATGGGCAGCCGGGGGCTTTGG - Intergenic
1076600498 10:131654308-131654330 CACTGGGCACCAGCAGCCTTAGG + Intergenic
1076631176 10:131853221-131853243 AAGGGGGCTCCCCGGGCCTTTGG - Intergenic
1077208360 11:1354978-1355000 CACAGGGCACCAGGGGCTTTGGG - Intergenic
1077320043 11:1937031-1937053 CACTGGGCACAGGGGCCCTTGGG + Intronic
1077866347 11:6224469-6224491 GACTGGCCTCCCGGGGCCCTGGG - Exonic
1078747395 11:14128467-14128489 AGGTGGGCTCCCGAGGCCTTGGG + Intronic
1080129750 11:28780526-28780548 AGGTGGGCTCCCAGGGCCTTGGG + Intergenic
1081769745 11:45642314-45642336 CAGTGGGCTCCCTGGGCCTTAGG + Intergenic
1083727759 11:64637283-64637305 CACTGTGCTCCAGGGCCCTCAGG - Intronic
1084151897 11:67291534-67291556 CTCTGGGCTCCCAGGGATTTGGG + Intronic
1084426431 11:69086812-69086834 ATCTGGGCTGCTGGGGCCTTGGG + Intronic
1084426443 11:69086848-69086870 ATCTGGGCTGCTGGGGCCTTGGG + Intronic
1084730782 11:71072182-71072204 CCCTGGGCTCACGGGGGCATAGG - Intronic
1084779211 11:71397568-71397590 CGCTGGGCTCCAGGGACCCTGGG + Intergenic
1085273912 11:75286080-75286102 CCCTGGGCTCCCAGGGCCAGGGG - Intronic
1086309803 11:85522618-85522640 CGGTGGGCTCCCATGGCCTTGGG - Intronic
1086799336 11:91152335-91152357 GAGTGGGCTCCCAAGGCCTTTGG + Intergenic
1087045288 11:93839286-93839308 GACTGGGCTCCCGTGGCCCAGGG + Intronic
1087497649 11:98910499-98910521 AACTGGGCTCCTAAGGCCTTGGG - Intergenic
1088596251 11:111442642-111442664 CAGTGGGCTACGGGGTCCTTTGG - Intronic
1090709927 11:129375348-129375370 CACTAGGCTCCCGGGACTTCGGG - Intergenic
1091452980 12:585240-585262 CACTGGGCTCTGGGGGCTCTGGG + Intronic
1091552954 12:1550618-1550640 CAGTGGGCTCCCAAGGCCTTGGG - Intronic
1092193359 12:6535223-6535245 CACTAGCATCCCGGGGCCTGCGG - Intronic
1092662602 12:10755203-10755225 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
1094494676 12:30982031-30982053 CACTGGTCTCCCAGTGCCATGGG + Intronic
1095242681 12:39879454-39879476 GGCTGGGCTCCCAAGGCCTTGGG - Intronic
1095382877 12:41615928-41615950 AGGTGGGCTCCCGTGGCCTTGGG - Intergenic
1095640825 12:44483274-44483296 AAATGGGCTCCCATGGCCTTGGG + Intergenic
1095836738 12:46647828-46647850 CGGTGGGCTCCCATGGCCTTGGG + Intergenic
1096411327 12:51379065-51379087 CACAGGTCTCCCTGGGCCTCTGG + Intronic
1096714458 12:53482832-53482854 CACTAGGGTCCCGGGGCCGGGGG - Exonic
1097223062 12:57461674-57461696 TACTGGGCTCCCGGGGCGGGTGG + Intronic
1098474473 12:70884258-70884280 TACTGGGCTTTCGGGGCATTTGG - Intronic
1099663431 12:85596258-85596280 CAGTGGGCTCCCACAGCCTTGGG + Intergenic
1099898811 12:88681914-88681936 AAGTGGGCTCCCAAGGCCTTGGG - Intergenic
1102298349 12:111754160-111754182 CCCTGGACTCCCAGGGCCATTGG + Intronic
1103488081 12:121296399-121296421 CTCTGGGCGCCCTGGGCCTCGGG - Intronic
1103649440 12:122422048-122422070 CGCCGGGCACCCGGGGCCTGAGG + Intronic
1104001542 12:124863677-124863699 CGCTGGGCTGCCGGGGCGCTGGG - Exonic
1105257629 13:18754790-18754812 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1105258041 13:18757872-18757894 GCCTGGGCTCCCAAGGCCTTGGG + Intergenic
1105259369 13:18767491-18767513 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1105260281 13:18774099-18774121 GCCTGGGCTCCCAAGGCCTTGGG + Intergenic
1105260698 13:18777177-18777199 GCCTGGGCTCCCAAGGCCTTGGG + Intergenic
1105262049 13:18786813-18786835 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1105262990 13:18793583-18793605 GCCTGGGCTCCCAAGGCCTTGGG + Intergenic
1106338920 13:28809673-28809695 AGGTGGGCTCCCAGGGCCTTGGG - Intergenic
1106472122 13:30065385-30065407 CACTGGGCTGCTGTGGCCTGGGG + Intergenic
1106517208 13:30465564-30465586 CGCGGGGCTCCCGGCGCCTCAGG + Intronic
1107013343 13:35689511-35689533 CCAGGGGCTCCTGGGGCCTTTGG + Intergenic
1107472487 13:40703603-40703625 CACAGGGCTCCAAGCGCCTTGGG - Intergenic
1108179110 13:47823391-47823413 CAATGGGCTGCTGTGGCCTTTGG + Intergenic
1108885725 13:55178783-55178805 AAGTGGGCTCCCATGGCCTTGGG - Intergenic
1111207209 13:85027019-85027041 AGGTGGGCTCCCAGGGCCTTGGG + Intergenic
1111328080 13:86725411-86725433 CCATGGACTCCCTGGGCCTTTGG + Intergenic
1112857158 13:103786230-103786252 CAGTGAGCTCCCATGGCCTTGGG + Intergenic
1113902864 13:113806290-113806312 CCCTGGGGTCCAGGGGCCTGTGG + Intronic
1117977214 14:61310510-61310532 GAGTGGGCTCCCATGGCCTTGGG + Intronic
1119495091 14:75071065-75071087 CTCTCGGCTCAGGGGGCCTTGGG - Exonic
1120405006 14:84083838-84083860 GGCTGGGCTCCCATGGCCTTAGG + Intergenic
1120571024 14:86116621-86116643 AGCTGGGCTCCCAAGGCCTTGGG - Intergenic
1121328660 14:93036140-93036162 CCTTGGGCTCCTGGGACCTTGGG - Intronic
1122287339 14:100659580-100659602 GACAGGGATTCCGGGGCCTTGGG + Intergenic
1122442356 14:101740826-101740848 GAGTGGGCTCCCAAGGCCTTGGG + Intergenic
1122786704 14:104167322-104167344 CACGGGGCTCCCAGGGACTAAGG + Intronic
1122955096 14:105066801-105066823 CACTGGCCTCCCGGGTCTTTGGG + Intergenic
1122969277 14:105145912-105145934 CACTGGGCGCTCAGGGCCTCGGG + Exonic
1122982093 14:105196558-105196580 CTCGGGGCTCCCGGGGGCTGGGG - Intergenic
1125464190 15:39934375-39934397 CCCTGGCCTCCCCGGGCCCTGGG + Intronic
1128105989 15:65045259-65045281 CACTGGGCTACTGGTGCTTTCGG + Intergenic
1128635330 15:69299027-69299049 CACTGGACTCCCGAGACCCTTGG + Exonic
1128720155 15:69942085-69942107 CGCTGGGCTCCCCAGGCCTCAGG + Intergenic
1129389416 15:75213216-75213238 CTCTGGGCCCCCCGGGCCCTGGG + Intergenic
1130778470 15:87009707-87009729 AAGTGGGCTCCCATGGCCTTGGG - Intronic
1131054437 15:89367410-89367432 TACTGGGCTCCCTGGGCCCTGGG + Intergenic
1131517741 15:93090039-93090061 CCCTGGGCTCCCGGAGCCTCTGG - Intergenic
1132661226 16:1062366-1062388 GGCTGGGCTCTCGGGGCCTCTGG + Intergenic
1132883571 16:2172737-2172759 CTCTGGGTTTCCAGGGCCTTGGG - Intronic
1132930560 16:2456915-2456937 CACTGCTCTCCGGGGGACTTGGG - Exonic
1135546823 16:23372006-23372028 CACGGGGCACCCCGGGCCTGTGG + Intronic
1135684226 16:24485295-24485317 AATTGGGCTCCTGGGGCCTGAGG - Intergenic
1136567840 16:31080623-31080645 GACTGCGCTCCCCTGGCCTTGGG - Exonic
1136592676 16:31226873-31226895 CAATGGGCTGCCGGGGCCCCAGG - Intergenic
1137570712 16:49564681-49564703 CACTGAGCTCCTGGAGCCTTTGG + Intronic
1137611589 16:49821802-49821824 CACGGGGCTCCCCAGGCCTCAGG + Intronic
1142249186 16:88983329-88983351 CACTGAGCCCCCTAGGCCTTGGG - Intergenic
1142251929 16:88995989-88996011 CCCTGGGCTCCCCGGGTCTGCGG + Intergenic
1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG + Intergenic
1143178479 17:4969830-4969852 GACTGGGCTCCCAGGGCTTTTGG - Intronic
1145022638 17:19443598-19443620 AGGTGGGCTCCCAGGGCCTTGGG - Intergenic
1145230404 17:21169746-21169768 CACTGGCCTCCAGGGGCCCACGG + Intronic
1146547068 17:33748976-33748998 CCCTGGGCTCAGGGGGCCCTCGG + Intronic
1147608057 17:41785471-41785493 CGCTGGGCCCCAGGGGCCTGAGG - Intronic
1150493929 17:65593006-65593028 CACAGGGCTCCCTGGTCCCTGGG + Intronic
1150830828 17:68518068-68518090 AGGTGGGCTCCCGTGGCCTTGGG + Intronic
1151092458 17:71458316-71458338 CACTGGGCTCCCTTGTCCTCTGG - Intergenic
1151377066 17:73697159-73697181 CACTGGGCTTGGGGGGTCTTTGG + Intergenic
1151974987 17:77479685-77479707 CTCTGGGCTCCAGGGGCGTTGGG + Intronic
1152097421 17:78280072-78280094 CACAGGGAGCCCTGGGCCTTGGG + Intergenic
1152112980 17:78367342-78367364 CACTGTACTCACTGGGCCTTAGG + Intergenic
1152310785 17:79548436-79548458 CACGGGGCTGCCAGGCCCTTTGG - Intergenic
1152468098 17:80476837-80476859 CCCTGAGCTCTCGGAGCCTTCGG - Intronic
1152730090 17:81965899-81965921 CACTCCGCTCACGGGGCCTCAGG - Intergenic
1153348294 18:4052000-4052022 GAGTGGGCTCCCATGGCCTTGGG + Intronic
1154369379 18:13745196-13745218 CACTGGGCTCCAGTGCACTTAGG - Intronic
1154428049 18:14287200-14287222 GCCTGGGCTCCCAAGGCCTTGGG - Intergenic
1154428481 18:14290289-14290311 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
1154429382 18:14296897-14296919 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
1154430761 18:14306712-14306734 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
1154431239 18:14310118-14310140 GTCTGGGCTCCCAAGGCCTTGGG - Intergenic
1154433428 18:14325937-14325959 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
1154434349 18:14332548-14332570 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
1155043260 18:22082684-22082706 CACTGGGCCTCCTGGGCCTGCGG - Intergenic
1155168189 18:23247891-23247913 CACTGGGCTCCCTGGGCCAAGGG + Intronic
1156341338 18:36212853-36212875 TACTGGGCCCCCAGGCCCTTGGG + Intronic
1157039982 18:44027474-44027496 CAGTGGTCTCCCAAGGCCTTGGG + Intergenic
1157392051 18:47311142-47311164 CACAAGGCTCCCGGTGCATTAGG - Intergenic
1160381288 18:78458155-78458177 CACTGAGCTCTCAGGGCCCTCGG - Intergenic
1160573822 18:79837267-79837289 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
1160986788 19:1842901-1842923 CGCTGGGTTCCCAGGGCCTGGGG - Intronic
1161083282 19:2321999-2322021 CACTGGTCTCTAGGGGCCATGGG - Intronic
1161233458 19:3186815-3186837 CACTTGGCACCCAGGGCCGTGGG - Intronic
1161404094 19:4082090-4082112 CACTGGGCTCCCTGGGCTCTTGG - Intergenic
1161420617 19:4174440-4174462 CCCTGGGCTCCAGGGGCCTCTGG - Exonic
1162325389 19:9996205-9996227 CACTGGGCGCCCAGGCCCTGTGG - Exonic
1162458561 19:10800671-10800693 CACTGGACTCCCCTGGCCCTTGG - Intronic
1162577606 19:11507896-11507918 GGCTGGGCTCCCTGGGCCTCTGG - Intronic
1164086069 19:21903775-21903797 AAGTGGGCTCCCAAGGCCTTGGG + Intergenic
1164675008 19:30095079-30095101 CACAAGGCTCACTGGGCCTTGGG + Intergenic
1165435279 19:35791793-35791815 GTCTGGGTTCCAGGGGCCTTCGG + Intergenic
1166230600 19:41424098-41424120 CACTGGGCTGCACGGGCCCTGGG - Intronic
1166326238 19:42052787-42052809 CAATGGGCTTCCAGTGCCTTAGG - Intronic
1168279024 19:55294143-55294165 GACTGGGCTCCCGAGACCCTGGG + Intronic
1168423676 19:56222040-56222062 GACTGGGCTCGCAGGGCCTGGGG + Exonic
1168655312 19:58123279-58123301 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
925289674 2:2739127-2739149 CACCTGCCTCACGGGGCCTTGGG - Intergenic
925393189 2:3512943-3512965 GAATGGGCTCCCAAGGCCTTAGG - Intronic
925877818 2:8327720-8327742 CACTTGTCTCCAGGGGCCTTGGG - Intergenic
927154194 2:20212393-20212415 CACTGGGCTCCCCCAGCCTCGGG + Intronic
929602138 2:43211025-43211047 CTCAGGGCTCCTGGGGCCTGAGG - Intergenic
930687593 2:54325874-54325896 AGCTGGGCTCCCAAGGCCTTGGG - Intergenic
931096176 2:58943267-58943289 AAGTGGGCTCCCATGGCCTTGGG - Intergenic
931955415 2:67418773-67418795 GAGTGGGCTCCCAAGGCCTTGGG + Intergenic
932165087 2:69498518-69498540 CACTGGGCTCTCGGGGGCAGGGG - Intronic
932497674 2:72154537-72154559 CTCTTGGCTCCCCGGGCCTGAGG - Intergenic
932537655 2:72617149-72617171 AAGTGGGCTCCCACGGCCTTGGG + Intronic
933759638 2:85664826-85664848 CCCTGGGCTGGCGGGGCCATTGG + Intronic
934491751 2:94765946-94765968 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
934492194 2:94769076-94769098 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
934492778 2:94773088-94773110 CCCTGGGCTCCCAAGGCCTTGGG + Intergenic
934493618 2:94779336-94779358 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
934494095 2:94782534-94782556 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
935792034 2:106601671-106601693 AAGTGGGCTCCCAAGGCCTTGGG + Intergenic
935846346 2:107169866-107169888 CTCTGAGCTCCCAGGCCCTTTGG - Intergenic
936144681 2:109972565-109972587 CACTGGGCTCCCAGAGCTTGGGG - Intergenic
936164034 2:110104684-110104706 CACCTGGCTCCCAGGGCCTCTGG + Intronic
936181366 2:110270528-110270550 CACTGGGCTCCCAGAGCTTGGGG - Intergenic
936200006 2:110398904-110398926 CACTGGGCTCCCAGAGCTTGGGG + Intergenic
936821844 2:116530824-116530846 GAGTGGGCTCCCAAGGCCTTGGG - Intergenic
937462731 2:122103368-122103390 GAGTGGGCTCCCAAGGCCTTGGG + Intergenic
937689827 2:124742982-124743004 CACTGTGCTTCCGGGGCCTGGGG - Intronic
937889541 2:126926717-126926739 TAATGGGCTCCCATGGCCTTGGG - Intergenic
937956886 2:127426693-127426715 CACTGGGCTGCCGGGTCTTTGGG - Intronic
937992429 2:127672131-127672153 CACTGAGCTCACGTGGCCGTGGG + Intronic
937995364 2:127690364-127690386 AGCTGGGCTCCCAAGGCCTTGGG + Intergenic
938279744 2:130055539-130055561 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
938280058 2:130057461-130057483 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
938330695 2:130446253-130446275 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
938331015 2:130448176-130448198 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
938341050 2:130536819-130536841 CACTGGTCCCTCAGGGCCTTGGG + Intergenic
938348780 2:130583890-130583912 CACTGGTCCCTCAGGGCCTTGGG - Intronic
938358933 2:130673327-130673349 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
938359249 2:130675250-130675272 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
938435651 2:131281899-131281921 GGCTGGGCTCCCAAGGCCTTGGG - Intronic
939482910 2:142771449-142771471 GAGTGGGCTCCCAAGGCCTTTGG - Intergenic
942367553 2:175243633-175243655 CACTGGGTTCCCTGGGTCCTGGG + Intergenic
943896690 2:193371390-193371412 CACAGGACTCCCTCGGCCTTTGG - Intergenic
944675781 2:202033697-202033719 CATTGGGCCGCCGGGGCCTGGGG + Intergenic
945515820 2:210762473-210762495 GAGTGGGCTCCCAAGGCCTTGGG + Intergenic
946160055 2:217830489-217830511 GACAGGGCTCCCTGGGCCCTTGG - Intronic
947011448 2:225571103-225571125 AATTGGGCTCCCATGGCCTTGGG + Intronic
947038996 2:225893356-225893378 CACTGGGCTACCTTGACCTTTGG - Intergenic
948226188 2:236311067-236311089 CACTGTGCTCAGGGAGCCTTGGG + Intergenic
1168987046 20:2058304-2058326 CACTGGGCACCTGGGGGCTGGGG + Intergenic
1170482019 20:16775294-16775316 GAGTGGGCTCCCAAGGCCTTGGG - Intergenic
1171883847 20:30637316-30637338 GCCTGGGCTCCCAAGGCCTTGGG + Intergenic
1171884768 20:30643952-30643974 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1171885233 20:30647136-30647158 GGCTGAGCTCCCAGGGCCTTGGG + Intergenic
1171958084 20:31475160-31475182 CACTGAGCGGCCAGGGCCTTGGG + Intronic
1173769902 20:45647471-45647493 CTCTGGGTTCACTGGGCCTTGGG + Intergenic
1175241444 20:57552499-57552521 CAGTGGGGTCCCTGGGCTTTTGG - Intergenic
1175687750 20:61043958-61043980 CACTGGCTACCTGGGGCCTTCGG - Intergenic
1176413264 21:6460125-6460147 CACTGGGCTCCGTGGGCCTGGGG - Intergenic
1176842691 21:13853170-13853192 AGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1176843616 21:13859813-13859835 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1176844035 21:13862901-13862923 GCCTGGGCTCCCAAGGCCTTGGG + Intergenic
1176845384 21:13872517-13872539 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1176845807 21:13875647-13875669 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1176846288 21:13879133-13879155 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1176848542 21:13895201-13895223 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1176849025 21:13898675-13898697 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1177222959 21:18217957-18217979 AGGTGGGCTCCCAGGGCCTTGGG + Intronic
1177408391 21:20699354-20699376 AACTGGGGTCCCGTGGCCTTGGG - Intergenic
1178634160 21:34287962-34287984 AGGTGGGCTCCCGAGGCCTTGGG + Intergenic
1179060315 21:37973531-37973553 CACTGGCCTCCCTGGGCCTCTGG - Intronic
1179089900 21:38255484-38255506 CACTGGGCTCCCAGGGGTTCAGG - Intronic
1179688761 21:43068447-43068469 CACTGGGCTCCGTGGGCCTGGGG - Intronic
1179718024 21:43299985-43300007 CACTTGACTCTCGGGGCCTGAGG + Intergenic
1179809397 21:43860800-43860822 GACTGGGCCCCCTGGGCCTTGGG + Intergenic
1180066965 21:45417410-45417432 CCCTGGGTTCCCCGGGGCTTGGG + Intronic
1180079791 21:45481415-45481437 CACTGGCATCCCGTGGCCTGGGG + Intronic
1180092542 21:45540399-45540421 CCCAGGGCTCCCGGGCCCCTGGG - Intronic
1181921001 22:26320422-26320444 CAGTGTCATCCCGGGGCCTTAGG + Intronic
1182468960 22:30535386-30535408 CACTTGGTCCCCAGGGCCTTGGG + Intronic
1182890993 22:33818776-33818798 CACTGGGCTCCCTGGTCCTTGGG - Intronic
1183402284 22:37611590-37611612 CACTGGGATTCCAGGGCTTTGGG + Intronic
1183649422 22:39145585-39145607 CACTGGGCTCGCGGCGCCGGCGG + Intronic
1184011803 22:41754336-41754358 CACTGGACTCCTGAGGCCTATGG - Intronic
1184241350 22:43212699-43212721 TACTGGGCACCCGAGGCCTGGGG + Intronic
1184861376 22:47174864-47174886 TCCTTGGCTCCAGGGGCCTTGGG + Exonic
1185236482 22:49716529-49716551 CGCTGGGCTCCCAGGACCTTTGG + Intergenic
950146076 3:10650863-10650885 AGGTGGGCTCCCGTGGCCTTGGG - Intronic
951755559 3:26087458-26087480 CAGTGGGCTCCCACAGCCTTGGG + Intergenic
952480164 3:33753433-33753455 AACTTGGCTCCCATGGCCTTAGG + Intergenic
953446694 3:42974510-42974532 AGGTGGGCTCCCGTGGCCTTGGG - Intronic
954145860 3:48633999-48634021 CAGTGGGCTCCCGGGGCAGCTGG - Intronic
954686112 3:52371168-52371190 GACTGGGCTCCCGAGGGCTGGGG + Intronic
954714751 3:52521474-52521496 CTCTGTGCTCCTGGTGCCTTTGG + Exonic
955465194 3:59230052-59230074 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
958710284 3:97709248-97709270 AAGTGGGCTCCCAAGGCCTTTGG - Intronic
958927965 3:100179595-100179617 GAGTGGGCTCCCAAGGCCTTAGG + Intergenic
958935404 3:100250786-100250808 AAGTGGGCTCCCCAGGCCTTGGG + Intergenic
959070964 3:101701801-101701823 CACTGGTATCCAGGGGCCATAGG + Intergenic
959530704 3:107431448-107431470 CTCTGGGTTCCCGCGGCCTGTGG + Intergenic
962751008 3:138434832-138434854 CGCTGGGCTCCCAGGGCGCTGGG - Exonic
965857176 3:173103102-173103124 GGGTGGGCTCCCAGGGCCTTAGG + Intronic
967220904 3:187247266-187247288 CTCTGGGCCCCAGGGGTCTTGGG + Intronic
967519805 3:190416381-190416403 AACTGGGCTCCCATGGCCTTGGG + Intergenic
967577260 3:191108226-191108248 GACTGGGCTTCCAAGGCCTTGGG - Intergenic
967749917 3:193101784-193101806 GAGTGGGCTCCCATGGCCTTGGG - Intergenic
968190836 3:196665960-196665982 CAATGGGCTCCCTTGCCCTTTGG + Intronic
968350719 3:198049743-198049765 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
968579527 4:1383486-1383508 CTCTGGGCTGCAGGGGCCTGTGG + Intronic
968599838 4:1503697-1503719 CCTGGGGCTGCCGGGGCCTTAGG - Intergenic
968968638 4:3782076-3782098 CACTCGGCCCCAGGGGCCTCCGG + Intergenic
969125651 4:4945931-4945953 CCCTGGGCTCCCATGGCATTTGG + Intergenic
971939844 4:33200298-33200320 AGGTGGGCTCCCAGGGCCTTAGG - Intergenic
972793923 4:42398031-42398053 CACTGGGCTCCCTGGGCGGCCGG - Exonic
973012412 4:45093251-45093273 CAGTGGGCTCCCAAGGTCTTGGG + Intergenic
973367506 4:49219586-49219608 GCCTGGGCTCCCAAGGCCTTGGG + Intergenic
973368414 4:49226235-49226257 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
973392632 4:49569190-49569212 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
975456546 4:74597618-74597640 AGGTGGGCTCCCAGGGCCTTGGG - Intergenic
976715700 4:88120490-88120512 AGGTGGGCTCCCAGGGCCTTGGG - Intronic
976952528 4:90850481-90850503 AAGTGGGCTCCCATGGCCTTGGG - Intronic
978322741 4:107515989-107516011 GAGTGGGCTCCCAAGGCCTTGGG - Intergenic
979087262 4:116428677-116428699 GACTGGGCTCACAAGGCCTTGGG - Intergenic
979682528 4:123477565-123477587 CACTGGTTTCTCGGGGCCCTGGG - Intergenic
980168115 4:129252698-129252720 AAGTGGGCTCCCAAGGCCTTGGG - Intergenic
980993841 4:139762019-139762041 CACTGGGCTCCCTGGGCTCTCGG - Intronic
981131437 4:141162182-141162204 GAGTGGGCTCCCAAGGCCTTAGG - Intronic
981359690 4:143831945-143831967 AGGTGGGCTCCCGTGGCCTTGGG - Intergenic
982301264 4:153881431-153881453 AAGTGGGCTCCCATGGCCTTGGG - Intergenic
983020394 4:162669638-162669660 AGCTGGGCTCCCAAGGCCTTGGG + Intergenic
984756671 4:183331336-183331358 CCCTGGGCTTCCGGGACCTGCGG + Intergenic
985617715 5:934038-934060 GAGTGGGCTCCCATGGCCTTGGG + Intergenic
985644422 5:1078293-1078315 CCCAGGACCCCCGGGGCCTTGGG + Intronic
985972151 5:3386926-3386948 CACTGGGCTCTCAGTGCCATGGG - Intergenic
986673796 5:10166639-10166661 CCCTGGGCTCCAGGTCCCTTTGG + Intergenic
986869698 5:12031706-12031728 TAGTGGGCTCCCAAGGCCTTGGG - Intergenic
987303304 5:16616576-16616598 CACTGGGTCCCCGGGGCCCCGGG + Intronic
987658474 5:20839753-20839775 GAGTGGGCTCCCAAGGCCTTAGG - Intergenic
987918508 5:24248395-24248417 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
988074730 5:26338369-26338391 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
988080724 5:26411151-26411173 AAGTGGGCTCCCACGGCCTTGGG - Intergenic
988448030 5:31310330-31310352 GAGTGGGCTCCCATGGCCTTGGG + Intronic
988540081 5:32100600-32100622 CTCTGGGTTCCTGGGGGCTTTGG + Intronic
988765211 5:34366191-34366213 GAGTGGGCTCCCAAGGCCTTAGG + Intergenic
989130042 5:38098295-38098317 CACTTGACTCCCACGGCCTTTGG - Intergenic
990136083 5:52645459-52645481 GGGTGGGCTCCCAGGGCCTTGGG - Intergenic
991257338 5:64629695-64629717 CAGTGGGCTCCCTTGCCCTTTGG + Intergenic
993037034 5:82769663-82769685 AAGTGGGCTCCCATGGCCTTAGG - Intergenic
993531085 5:89026701-89026723 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
995477644 5:112563894-112563916 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
995701433 5:114939563-114939585 GAGTGGGCTCCCAGGGCCTTGGG - Intergenic
995743742 5:115381992-115382014 CCCTGGGCACCCCAGGCCTTTGG - Intergenic
995761431 5:115565958-115565980 AAATGGGCTCCCAAGGCCTTGGG - Intergenic
996049631 5:118917559-118917581 CACAGGGCTCCGGAGGCCTTAGG + Intronic
996838712 5:127822854-127822876 CACTGGGCCTCAGGGGCCTGAGG - Intergenic
997530852 5:134580320-134580342 CAGTGGGATCCCGGGGCCCAGGG + Exonic
997575815 5:134976437-134976459 GGGTGGGCTCCCGGGGCCTTGGG + Intronic
997977102 5:138446881-138446903 CGCGGGGCTCCCGGTTCCTTGGG + Exonic
998256768 5:140594305-140594327 CACTGGGCTCTCTGGGCCGAGGG - Intergenic
998756887 5:145391006-145391028 AAATGGGCTCCCATGGCCTTGGG + Intergenic
1000637486 5:163660391-163660413 AACTGGGCTCCCTGGCCCTTTGG - Intergenic
1001043975 5:168356920-168356942 GACAGGGCTCCCAGGGCCCTAGG - Intronic
1001500101 5:172224713-172224735 CACAGGGCTGAGGGGGCCTTAGG - Intronic
1004076799 6:12351262-12351284 GAGTGGGCTCCCAAGGCCTTAGG + Intergenic
1004217002 6:13712008-13712030 CGCTGGGCTCCCGGCGCCGCAGG + Intergenic
1004606821 6:17202640-17202662 GAGTGTGCTCCCGGGACCTTTGG - Intergenic
1004756678 6:18618017-18618039 GATTGGGCTCCCAAGGCCTTAGG + Intergenic
1004958498 6:20757477-20757499 CAGTGAGGTCCCGGGGTCTTTGG - Intronic
1005494339 6:26375545-26375567 CACTGGGCTCCCTTGTCCTCTGG - Intronic
1005498830 6:26412442-26412464 CACTGGGCTCCCTTGTCCTCTGG - Intronic
1006479906 6:34283738-34283760 CTCTGGGCTCCCAGGACCTGTGG + Exonic
1008189652 6:48439058-48439080 GAGTGGGCTCCCAAGGCCTTGGG - Intergenic
1008498945 6:52161254-52161276 GGGTGGGCTCCCGAGGCCTTGGG - Intergenic
1010611084 6:77954241-77954263 GAGTGGGCTCCCAAGGCCTTGGG - Intergenic
1010650965 6:78455273-78455295 AGCTGGGCTCCCATGGCCTTAGG + Intergenic
1010678153 6:78768173-78768195 GAGTGGGCTCCCAAGGCCTTGGG - Intergenic
1012064830 6:94537217-94537239 AGGTGAGCTCCCGGGGCCTTGGG + Intergenic
1013730171 6:113155628-113155650 CGTTGGGCTCCCAAGGCCTTGGG - Intergenic
1014247419 6:119082680-119082702 AAGTGGGCTCCCAAGGCCTTGGG + Intronic
1016126381 6:140408793-140408815 GAGTGGGCTCCCAAGGCCTTGGG - Intergenic
1017584361 6:155904032-155904054 CACTGGGCACCAGGGTCCCTGGG + Intergenic
1018093195 6:160363027-160363049 GGCTGGGCTCCCGGGGACTCGGG + Intronic
1019664901 7:2247022-2247044 TGCTGGGTTCCCGGGGCCCTGGG - Intronic
1019729735 7:2623332-2623354 CCCTGGCCTCCCAGGGCCTCAGG - Intergenic
1019734485 7:2644094-2644116 CCCTGGGCTCCCATGGCCTGGGG - Intronic
1020730225 7:11870315-11870337 GACTGGGCTTCCAGGGCCGTGGG - Intergenic
1021719264 7:23490480-23490502 CCCAGGGCCCCCGGGGCCTCCGG - Intergenic
1022426366 7:30272403-30272425 CTCTGGGCTCCCCTGGCCTTTGG - Intergenic
1022712523 7:32865117-32865139 GAATGGGCTCCCAAGGCCTTGGG + Intergenic
1024526147 7:50350902-50350924 CACTTGGCTCCCTGGGTCCTTGG - Intronic
1026889248 7:73972621-73972643 CACTGGTCTAACGGGGCCCTGGG + Intergenic
1027937894 7:84632649-84632671 AAGTGGGCTCCCATGGCCTTGGG - Intergenic
1031790304 7:126093847-126093869 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1032346238 7:131119314-131119336 CGGTGGGCTCCCAAGGCCTTGGG + Intronic
1032418924 7:131762159-131762181 CTCCAGGCTCCCAGGGCCTTAGG - Intergenic
1033228909 7:139581678-139581700 CACTGGGCTCCAGGGAGCTGAGG + Intronic
1033732780 7:144195491-144195513 CCCTGGGCTCCCGGCGGCTGTGG - Intronic
1033743631 7:144294071-144294093 CCCTGGGCTCCCGGCGGCTGTGG - Intergenic
1033750271 7:144355526-144355548 CCCTGGGCTCCCGGCGGCTGTGG + Intronic
1034445127 7:151110195-151110217 CACTGTGCTCCCAGGGCTTTTGG - Intronic
1034561748 7:151884791-151884813 CAGTGAGCACCGGGGGCCTTTGG - Intergenic
1035092931 7:156329463-156329485 CACTGAGCTCCAGGGGCTTGTGG - Intergenic
1035296227 7:157868189-157868211 CACTGGGCTGTCGGAGCCATCGG - Intronic
1035463986 7:159063684-159063706 CAGTGGGGTCCAGGGGTCTTGGG + Intronic
1036364826 8:8111096-8111118 AAGTGGGCTCCCATGGCCTTGGG - Intergenic
1037415880 8:18649272-18649294 GAGTGGGCTCCCAAGGCCTTGGG - Intronic
1038272231 8:26084589-26084611 CACTCTGCTCCTGGGGTCTTGGG - Intergenic
1040102527 8:43518327-43518349 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
1042501579 8:69514911-69514933 CAGTGGGCTCCCAAGGCTTTGGG + Intronic
1044877262 8:96681796-96681818 AAGTGGGCTCCCATGGCCTTGGG - Intronic
1048551892 8:135441344-135441366 CACTGGGCTGCCAGAGCTTTGGG - Intergenic
1049243257 8:141549273-141549295 GACTGGGCCCCTGGGGACTTGGG + Intergenic
1049593839 8:143474487-143474509 CTCTGGGCTCCAGGGGCTTCTGG - Intronic
1049803256 8:144527818-144527840 CGCTGGGCTCCCAAGGCCTCCGG + Intronic
1051767390 9:20540116-20540138 GGCTGGGCTCCCAAGGCCTTGGG + Intronic
1051894005 9:21969945-21969967 CATTGGGCTCCTTGGGCCATAGG - Intronic
1052314032 9:27097683-27097705 GAATGGGCTCCCAAGGCCTTGGG - Intergenic
1052878270 9:33583728-33583750 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
1052879579 9:33593024-33593046 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
1053168290 9:35860032-35860054 CACTGGGCTCCCAGGCCAGTTGG - Intergenic
1053496402 9:38551209-38551231 GGCTGGGCTCCCAAGGCCTTGGG + Intronic
1053497712 9:38560479-38560501 GGCTGGGCTCCCAAGGCCTTGGG + Intronic
1053663969 9:40304592-40304614 GGCTGGGCTCCCAAGGCCTTGGG - Intronic
1053664936 9:40310798-40310820 GGCTGGGCTCCCAAGGCCTTGGG - Intronic
1053665377 9:40313901-40313923 GGCTGGGCTCCCAAGGCCTTGGG - Intronic
1053839134 9:42173703-42173725 AAGTGGGCTCCCATGGCCTTGGG - Intergenic
1053914511 9:42935848-42935870 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
1053914965 9:42938948-42938970 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
1053915397 9:42941872-42941894 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
1054376095 9:64450826-64450848 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
1054376528 9:64453931-64453953 GGCTGGGCTCCCAAGGCCTTGGG - Intergenic
1054519238 9:66062383-66062405 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1054519678 9:66065486-66065508 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1054520645 9:66071693-66071715 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1054915755 9:70494015-70494037 CACTGGGCTCCCTTGCCCTTAGG + Intergenic
1057226300 9:93295058-93295080 CACAGGGCTCCTGGAGCCCTAGG - Intronic
1057518159 9:95738724-95738746 CACTGGGTTTCCTGGCCCTTTGG - Intergenic
1057580938 9:96287238-96287260 CACTGGGCTCCCTTGGCCTCTGG - Intronic
1057676317 9:97138748-97138770 GGCTGGGCTCCCAAGGCCTTGGG + Intergenic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1058884429 9:109312806-109312828 CCCTGGGCTCCGGGTTCCTTGGG - Intronic
1059755936 9:117293552-117293574 CAATGGGTTCTCAGGGCCTTTGG - Intronic
1060182729 9:121545573-121545595 CTCTGGGATCCCAGGGCCTCAGG + Intergenic
1061761922 9:132857365-132857387 CACAGGGCCCCCGGGGTCTGGGG + Intronic
1062321752 9:135993556-135993578 CACTGGCCTCCTGGGCCCTGAGG + Intergenic
1062453027 9:136623418-136623440 CTCGGTGCTCCCGGGGCCCTGGG + Intergenic
1062571096 9:137185728-137185750 CTCTGGGCTCCCGGAGCCATAGG - Intronic
1062623952 9:137434681-137434703 AACTGGGCTTCCAGGGCCGTAGG - Exonic
1188578477 X:31681591-31681613 CATTGGGCTCCCATGCCCTTTGG - Intronic
1189869736 X:45369407-45369429 GAGTGGGCTCCCAAGGCCTTGGG - Intergenic
1192008601 X:67243046-67243068 CAGTGGGCTCCCATGGCTTTGGG - Intergenic
1192144110 X:68669536-68669558 CACTGGGAGCAGGGGGCCTTGGG - Intronic
1192841993 X:74866175-74866197 CAGTGGGATCCCACGGCCTTGGG - Intronic
1193801959 X:85946907-85946929 GAGTGGGCTCCCAAGGCCTTGGG - Intronic
1193871525 X:86804850-86804872 CAATAGGCTCCCAAGGCCTTGGG + Intronic
1194032682 X:88835902-88835924 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
1195035161 X:100965567-100965589 GAGTGGGCTCCCAAGGCCTTGGG - Intergenic
1195559899 X:106271433-106271455 CAGTTGGCTCCCCTGGCCTTTGG - Intergenic
1195562063 X:106294906-106294928 CAGTTGGCTCCCCTGGCCTTTGG + Intergenic
1196168863 X:112565400-112565422 CGGTGGGCTCCCAAGGCCTTGGG + Intergenic
1197223217 X:123932776-123932798 AAGTGGGCTCCCATGGCCTTGGG - Intergenic
1197758914 X:130014395-130014417 CGATGGGGTCCCTGGGCCTTTGG + Exonic
1198084342 X:133268310-133268332 CACTCCACTCCCAGGGCCTTGGG - Intergenic
1199993565 X:153004416-153004438 GGATGGGCTCCCAGGGCCTTGGG + Intergenic
1200000856 X:153059065-153059087 CACTGGGCTCCCGGGGCCTTAGG - Intronic
1200142336 X:153908368-153908390 CCCTGGGCTCCCTGGGCCTGGGG + Intronic