ID: 1200002360

View in Genome Browser
Species Human (GRCh38)
Location X:153068636-153068658
Sequence TTCAGCTGGCCCCAAAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200002360_1200002367 8 Left 1200002360 X:153068636-153068658 CCTGTGCTTTGGGGCCAGCTGAA No data
Right 1200002367 X:153068667-153068689 ATCGGCAGGAATGTGGTGAGAGG No data
1200002360_1200002372 22 Left 1200002360 X:153068636-153068658 CCTGTGCTTTGGGGCCAGCTGAA No data
Right 1200002372 X:153068681-153068703 GGTGAGAGGAGCTGGGGGCATGG No data
1200002360_1200002365 1 Left 1200002360 X:153068636-153068658 CCTGTGCTTTGGGGCCAGCTGAA No data
Right 1200002365 X:153068660-153068682 AGGCCAGATCGGCAGGAATGTGG No data
1200002360_1200002364 -6 Left 1200002360 X:153068636-153068658 CCTGTGCTTTGGGGCCAGCTGAA No data
Right 1200002364 X:153068653-153068675 GCTGAACAGGCCAGATCGGCAGG No data
1200002360_1200002362 -10 Left 1200002360 X:153068636-153068658 CCTGTGCTTTGGGGCCAGCTGAA No data
Right 1200002362 X:153068649-153068671 GCCAGCTGAACAGGCCAGATCGG No data
1200002360_1200002370 16 Left 1200002360 X:153068636-153068658 CCTGTGCTTTGGGGCCAGCTGAA No data
Right 1200002370 X:153068675-153068697 GAATGTGGTGAGAGGAGCTGGGG No data
1200002360_1200002368 14 Left 1200002360 X:153068636-153068658 CCTGTGCTTTGGGGCCAGCTGAA No data
Right 1200002368 X:153068673-153068695 AGGAATGTGGTGAGAGGAGCTGG No data
1200002360_1200002371 17 Left 1200002360 X:153068636-153068658 CCTGTGCTTTGGGGCCAGCTGAA No data
Right 1200002371 X:153068676-153068698 AATGTGGTGAGAGGAGCTGGGGG No data
1200002360_1200002373 30 Left 1200002360 X:153068636-153068658 CCTGTGCTTTGGGGCCAGCTGAA No data
Right 1200002373 X:153068689-153068711 GAGCTGGGGGCATGGCAACATGG No data
1200002360_1200002369 15 Left 1200002360 X:153068636-153068658 CCTGTGCTTTGGGGCCAGCTGAA No data
Right 1200002369 X:153068674-153068696 GGAATGTGGTGAGAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200002360 Original CRISPR TTCAGCTGGCCCCAAAGCAC AGG (reversed) Intergenic
No off target data available for this crispr