ID: 1200003195

View in Genome Browser
Species Human (GRCh38)
Location X:153072530-153072552
Sequence GCTGCGCGCCGCTGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 2, 1: 0, 2: 3, 3: 30, 4: 272}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200003195_1200003199 -4 Left 1200003195 X:153072530-153072552 CCGCCGCCGCAGCGGCGCGCAGC 0: 2
1: 0
2: 3
3: 30
4: 272
Right 1200003199 X:153072549-153072571 CAGCCCCCGACGCGCCCTGTGGG 0: 2
1: 0
2: 0
3: 8
4: 79
1200003195_1200003206 9 Left 1200003195 X:153072530-153072552 CCGCCGCCGCAGCGGCGCGCAGC 0: 2
1: 0
2: 3
3: 30
4: 272
Right 1200003206 X:153072562-153072584 GCCCTGTGGGGACCCGGACCAGG 0: 2
1: 0
2: 2
3: 13
4: 205
1200003195_1200003205 3 Left 1200003195 X:153072530-153072552 CCGCCGCCGCAGCGGCGCGCAGC 0: 2
1: 0
2: 3
3: 30
4: 272
Right 1200003205 X:153072556-153072578 CGACGCGCCCTGTGGGGACCCGG 0: 2
1: 0
2: 1
3: 5
4: 81
1200003195_1200003209 12 Left 1200003195 X:153072530-153072552 CCGCCGCCGCAGCGGCGCGCAGC 0: 2
1: 0
2: 3
3: 30
4: 272
Right 1200003209 X:153072565-153072587 CTGTGGGGACCCGGACCAGGAGG 0: 2
1: 1
2: 1
3: 18
4: 188
1200003195_1200003200 -3 Left 1200003195 X:153072530-153072552 CCGCCGCCGCAGCGGCGCGCAGC 0: 2
1: 0
2: 3
3: 30
4: 272
Right 1200003200 X:153072550-153072572 AGCCCCCGACGCGCCCTGTGGGG 0: 2
1: 0
2: 0
3: 5
4: 83
1200003195_1200003198 -5 Left 1200003195 X:153072530-153072552 CCGCCGCCGCAGCGGCGCGCAGC 0: 2
1: 0
2: 3
3: 30
4: 272
Right 1200003198 X:153072548-153072570 GCAGCCCCCGACGCGCCCTGTGG 0: 2
1: 0
2: 1
3: 11
4: 126
1200003195_1200003213 25 Left 1200003195 X:153072530-153072552 CCGCCGCCGCAGCGGCGCGCAGC 0: 2
1: 0
2: 3
3: 30
4: 272
Right 1200003213 X:153072578-153072600 GACCAGGAGGGACCCTGCCCCGG 0: 2
1: 0
2: 4
3: 33
4: 375
1200003195_1200003210 13 Left 1200003195 X:153072530-153072552 CCGCCGCCGCAGCGGCGCGCAGC 0: 2
1: 0
2: 3
3: 30
4: 272
Right 1200003210 X:153072566-153072588 TGTGGGGACCCGGACCAGGAGGG 0: 2
1: 0
2: 3
3: 17
4: 148
1200003195_1200003214 26 Left 1200003195 X:153072530-153072552 CCGCCGCCGCAGCGGCGCGCAGC 0: 2
1: 0
2: 3
3: 30
4: 272
Right 1200003214 X:153072579-153072601 ACCAGGAGGGACCCTGCCCCGGG 0: 2
1: 0
2: 1
3: 32
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200003195 Original CRISPR GCTGCGCGCCGCTGCGGCGG CGG (reversed) Exonic
900406923 1:2496816-2496838 GCTGGACGCCGCTGTGGCGCCGG - Exonic
900429989 1:2596843-2596865 TCTGGGTGCTGCTGCGGCGGGGG + Intronic
900512677 1:3068019-3068041 ACTCCGAGGCGCTGCGGCGGAGG - Intergenic
900989448 1:6091564-6091586 GCTGAGCTCCGCGGCGGCCGGGG + Intronic
901628977 1:10639034-10639056 GCTGCCCGAGGCGGCGGCGGAGG - Exonic
902323569 1:15684304-15684326 GCTGTGCGCCGCGGCGGCGGCGG - Intergenic
903034496 1:20485484-20485506 CCCGCGGGCTGCTGCGGCGGTGG + Exonic
903115636 1:21176594-21176616 GCTGCCGGCGGCGGCGGCGGCGG - Intronic
904724850 1:32539580-32539602 GCTGCACGCGGCGCCGGCGGAGG + Intronic
905066844 1:35192089-35192111 TGCGCGCGCCGCTGCGGGGGCGG - Intronic
905416464 1:37807931-37807953 GCTGCGCGCCGGCGCCGTGGTGG - Exonic
908473947 1:64470604-64470626 GCTCCGCGCCGCGGTGGCGAAGG - Intergenic
910981244 1:92961547-92961569 GGCGCGCGCCGCGGCGGGGGCGG - Intergenic
912363475 1:109113874-109113896 GCCGCGCGCACCAGCGGCGGCGG + Intronic
921060205 1:211578816-211578838 GCTGCGCGGCGCGGCGCCGCCGG - Intergenic
922440895 1:225653774-225653796 GCTGGGCGCAGCCGCGGCGAGGG - Intergenic
924511312 1:244730878-244730900 GCTGCGCGCCGCCGCGCCGGGGG + Intergenic
1062774713 10:135516-135538 GCCGGGCGCGGCGGCGGCGGCGG + Intronic
1063995088 10:11611518-11611540 GCGGCGCGGCGCGGCGGCGGCGG + Intronic
1064208969 10:13347774-13347796 GCCCCGCGCGGCGGCGGCGGCGG + Intronic
1064209073 10:13348105-13348127 GCCGCGCCCGGCGGCGGCGGCGG + Exonic
1064553112 10:16521715-16521737 GGTGCGCCCAGCGGCGGCGGCGG + Exonic
1065140473 10:22714454-22714476 GCTGAGCGCGCCGGCGGCGGCGG - Exonic
1067690280 10:48497365-48497387 GCTGAGCGCTGCTGAGGAGGAGG - Intronic
1069019145 10:63465992-63466014 GCTGCGCGCCGCCGCTGCCCGGG - Intergenic
1070570647 10:77637748-77637770 CCCGCGCTCCGCGGCGGCGGCGG - Intronic
1070800840 10:79243568-79243590 GCTCCGCGCCCCGGCGGCGGCGG - Intronic
1072102198 10:92239773-92239795 GGTGAGCGGCGCTGCTGCGGGGG + Exonic
1072190528 10:93073612-93073634 GCTGAGCTCCGAGGCGGCGGTGG - Intronic
1072263244 10:93702532-93702554 GTTGCGGGCGGCGGCGGCGGCGG - Exonic
1072409041 10:95183752-95183774 GCTGCCCCCTGCTGGGGCGGCGG - Intergenic
1072697049 10:97611599-97611621 GCTGAGCCCCGCTGAGGAGGAGG + Exonic
1072915485 10:99535284-99535306 GCCACGCGGCGCGGCGGCGGCGG - Exonic
1074591846 10:114821665-114821687 GCTAGGCGCCGCGGGGGCGGGGG - Intergenic
1076358494 10:129869764-129869786 GCTCTGCGCCTCTGCTGCGGAGG - Intronic
1076374335 10:129973158-129973180 GCTGGGCGCAGCTGCGGCCCCGG - Intergenic
1076792727 10:132785643-132785665 GCCGCGCGCCACAGCGGCCGCGG + Exonic
1076936134 10:133568298-133568320 CCTGCGCGTGGCTGCGGCCGGGG - Intronic
1077008371 11:369536-369558 GCTCCGCGCTCCTGGGGCGGCGG - Intergenic
1079408174 11:20163161-20163183 GCTGCGCGGCGCGGCGGCTGCGG + Intergenic
1080503806 11:32893259-32893281 GCTGCTGGCGGCGGCGGCGGCGG - Exonic
1080540080 11:33257256-33257278 GCTCCGCTCCGCTCCGGCCGCGG - Intronic
1081492581 11:43579620-43579642 GCCCCGCGCCGCGGCGGCGGCGG + Intronic
1083342436 11:61967462-61967484 GCTGCGCGGCGCTGGAGCGGCGG + Exonic
1083430681 11:62612472-62612494 GCTCCGAGCGGCGGCGGCGGAGG + Exonic
1083623646 11:64060928-64060950 CATGCGCACCGCGGCGGCGGCGG + Intronic
1083936517 11:65872565-65872587 GCCCCGCGCCCCTGCGGCGAAGG + Intronic
1084284162 11:68120939-68120961 TCTGCGGGCGGCTGCGGCGGCGG + Exonic
1085588574 11:77735063-77735085 GCTGCGTGGCGCTGGGGCGGCGG + Intronic
1088325116 11:108593293-108593315 GCTCCGAGCGGCTGCTGCGGAGG - Intronic
1089347041 11:117797204-117797226 CCAGCGCTCGGCTGCGGCGGCGG + Exonic
1090699180 11:129279244-129279266 GCGGCGCTCGGCGGCGGCGGCGG - Intronic
1090699312 11:129279630-129279652 GAGGCGCGCCGCCGCGGCCGCGG + Intergenic
1090780388 11:130002218-130002240 CCTGCGCGCTCCGGCGGCGGCGG - Intronic
1091473902 12:753372-753394 GCTGGGCCCAGCTGCGGCGGGGG - Exonic
1091498273 12:991154-991176 GCTGCGCCCCGCGGCGGGGCTGG + Intronic
1092239553 12:6828572-6828594 GCTGCGCGCCTACGCGGCCGGGG + Exonic
1096255068 12:50057787-50057809 GCGGCGTGCCGCGGCGGCCGCGG + Exonic
1096284146 12:50283549-50283571 CGTGCGCGCCCCCGCGGCGGTGG - Intergenic
1096863834 12:54549599-54549621 GCAGCGCGCGGCGGCGGCGGCGG + Exonic
1097109223 12:56645846-56645868 ACTGCGGGCCGCTCCGACGGCGG - Exonic
1097664845 12:62466914-62466936 GCTGGGCCCCGCGGCAGCGGAGG + Exonic
1097929673 12:65169973-65169995 GCTGCCAGCCGCGGGGGCGGCGG - Exonic
1098105958 12:67069303-67069325 GCTCCGGGCGGCGGCGGCGGCGG + Intergenic
1098550369 12:71755133-71755155 GCTGCGGCCGGCGGCGGCGGCGG + Exonic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1101131816 12:101697824-101697846 GCTGCGCTCGGTGGCGGCGGCGG + Exonic
1101340891 12:103841175-103841197 GCAGAGCGGCGCGGCGGCGGTGG - Exonic
1101606006 12:106248039-106248061 GGTCGGCGCCGCGGCGGCGGAGG - Intronic
1103562734 12:121800677-121800699 GCTGCCCGTGGCTGGGGCGGTGG - Intronic
1103856212 12:123972799-123972821 GCTAGGCGCCGGCGCGGCGGCGG + Exonic
1104441457 12:128796895-128796917 GCTGCGCGGCCCTGCGGGAGTGG + Intronic
1105678072 13:22696614-22696636 GCTGCGCGGCGCTGGAGCGGCGG + Intergenic
1106269487 13:28139105-28139127 GGGGCGGGCCGCGGCGGCGGAGG + Intronic
1106478028 13:30114800-30114822 GCTGCGGGAGGCGGCGGCGGCGG + Intergenic
1106480478 13:30133612-30133634 CCTGCGCGGCCCTGCGGCTGGGG - Intergenic
1107453671 13:40535473-40535495 GCTGGGCCCGGCTGCGGAGGTGG - Intergenic
1108373409 13:49792508-49792530 GCTGCGCGCGGCTCCGGCGGCGG + Exonic
1108615625 13:52129090-52129112 GCTGCGCCTCCCTGCGGCCGGGG + Intergenic
1110573019 13:77026785-77026807 GCCGAGCCCCGCTGCGACGGCGG - Intronic
1110860525 13:80341087-80341109 GCTGCGCGCCGCAGCGCTAGCGG - Intergenic
1111951315 13:94711546-94711568 GCTGCCCGCGGCGGCGGCGGCGG + Exonic
1112461443 13:99606722-99606744 GGCGCGCGGAGCTGCGGCGGCGG + Exonic
1113656103 13:112068506-112068528 GCCGCCCGCAGCGGCGGCGGCGG - Exonic
1115235792 14:31207665-31207687 GCTGCGGGCGACGGCGGCGGCGG + Intronic
1117377375 14:55129087-55129109 CCTGGTCGCCCCTGCGGCGGCGG + Exonic
1119249033 14:73136543-73136565 GCTACGAGCCGCGGCGGCAGCGG + Exonic
1121368150 14:93333068-93333090 CCTGCGCGGCGCTGCGGAGCCGG + Intronic
1121635314 14:95450062-95450084 GCTGCGCAATGCCGCGGCGGTGG - Exonic
1122162295 14:99793296-99793318 GGCTCGCGCGGCTGCGGCGGCGG + Intronic
1122220979 14:100239073-100239095 GGCGGGCGCCGCGGCGGCGGCGG - Exonic
1122270766 14:100567682-100567704 GGCCCGGGCCGCTGCGGCGGGGG - Intronic
1122779155 14:104136364-104136386 GGTGCGGGGCGCGGCGGCGGCGG + Intergenic
1123500787 15:20878737-20878759 TCGGCGCGCCGCTGCGGACGCGG + Intergenic
1123558037 15:21452430-21452452 TCGGCGCGCCGCTGCGGACGCGG + Intergenic
1123594265 15:21889711-21889733 TCGGCGCGCCGCTGCGGACGCGG + Intergenic
1124109470 15:26772999-26773021 GCTGCGGGTCGCGACGGCGGCGG - Exonic
1125508783 15:40282023-40282045 GCCCCGGGCCGCAGCGGCGGCGG + Exonic
1126849871 15:52790373-52790395 AGGGCGGGCCGCTGCGGCGGCGG - Intronic
1131195617 15:90352434-90352456 GCAGCGCGCCGCTGCCGCCGCGG - Intronic
1132055538 15:98648449-98648471 TCGGCGCGCCGCTGCTGCGGCGG + Intergenic
1132055673 15:98648976-98648998 GGAGCTCGCCGCGGCGGCGGCGG + Exonic
1132453298 15:101980243-101980265 GCGGCGCGCCTTTGCGACGGCGG + Intergenic
1132515285 16:363195-363217 GCTGCGGGGCGCTGCGGCAGAGG + Intergenic
1132877937 16:2148595-2148617 GCTGCGCGCCCGTGGAGCGGCGG + Intronic
1132915280 16:2340577-2340599 CCTGGGCGCCGGGGCGGCGGCGG + Exonic
1132947170 16:2538068-2538090 GCCGCGCAGCGCTGCGGGGGAGG + Exonic
1133051603 16:3120271-3120293 GCTGGGGGCGGCGGCGGCGGGGG + Exonic
1133784349 16:8963350-8963372 GCGGCGAGCCGGGGCGGCGGCGG + Exonic
1136365218 16:29806491-29806513 GCGGAGCGCCGCGGCGACGGCGG - Intronic
1136395694 16:29991425-29991447 GCTGCCCGCCGCAGGGGCTGGGG - Intronic
1137412930 16:48244635-48244657 GCCGCCCGCCGCCGCCGCGGGGG - Intronic
1137655128 16:50153136-50153158 GCTGCGCGGCGCAGCGGGGGCGG + Intronic
1137694971 16:50455456-50455478 GCTGCGGGCCCCTGGGGCTGAGG - Intergenic
1140223249 16:73058691-73058713 GCTGCTGGCGGCGGCGGCGGCGG + Intronic
1140529017 16:75648182-75648204 GCTGGGCCCCGCCTCGGCGGCGG + Exonic
1140927587 16:79599211-79599233 GCTGGGGGCGGCGGCGGCGGCGG - Exonic
1142852673 17:2711726-2711748 CCTGCGCGCCGCGGCTGCTGAGG + Intronic
1143245948 17:5486060-5486082 GCTGCTCACCACGGCGGCGGTGG + Exonic
1143633657 17:8152368-8152390 GCTGCGGGCTGGAGCGGCGGCGG - Exonic
1143635782 17:8163066-8163088 GCTGCGGGGCGCTGCGGGGCGGG + Intronic
1144021165 17:11241068-11241090 GCTCCGGGCGGCGGCGGCGGCGG - Intergenic
1144909908 17:18672505-18672527 GCCGCCCCCGGCTGCGGCGGTGG + Intronic
1146322608 17:31858824-31858846 GCTGGGCGCCGCTGCGGATTTGG - Intronic
1147661924 17:42121307-42121329 GCCGCTCTCCGCTGCGGGGGAGG - Exonic
1147907593 17:43833047-43833069 GCTGGGCGCCGCGGCGGGAGGGG - Intronic
1148323720 17:46771752-46771774 GCGGCGCGGCGCGGGGGCGGGGG - Intronic
1148591158 17:48817432-48817454 GCTGCGCGGGGCTGCGGTGAGGG + Intergenic
1148685354 17:49497577-49497599 GCCGCGCGCCGAGGCGGAGGCGG - Intronic
1148836565 17:50468836-50468858 GCTGGGGGCAGCAGCGGCGGCGG + Exonic
1150060592 17:62065386-62065408 GCTGCTCGCGGCGGCGGCGGCGG - Intergenic
1151660669 17:75516498-75516520 GCAGCGCGGAGCTCCGGCGGTGG + Intronic
1151662344 17:75525591-75525613 GCTCGGCGCCGCAGGGGCGGGGG - Intronic
1152072563 17:78141085-78141107 GCTCCGCGCCGCTGGGGAAGCGG - Exonic
1152677258 17:81648062-81648084 GCGGCCCGCCGCTCCGGCGGTGG + Exonic
1152721899 17:81927506-81927528 GGTGAGTGCGGCTGCGGCGGCGG - Exonic
1153480811 18:5544073-5544095 GCTCCGCGGAGCTGCGGCGGGGG + Exonic
1153514389 18:5891017-5891039 GCTGCTAGCGGCTGCGGCGGCGG + Exonic
1154416304 18:14177768-14177790 GCTGCCCGCAGCAGCGGTGGGGG + Intergenic
1157706800 18:49813963-49813985 GCGGGGCGCGGCGGCGGCGGCGG + Intronic
1159911252 18:74148329-74148351 GCTGCGCGTCCCTGGAGCGGCGG - Intergenic
1160680318 19:409109-409131 GATGCGGGCGGCGGCGGCGGCGG + Exonic
1160745393 19:708996-709018 GCTGCGCGGCGCGGGGGCGGCGG - Intergenic
1160829259 19:1095324-1095346 GGTGCGAGCGGCGGCGGCGGCGG - Exonic
1160853547 19:1206052-1206074 GCGGGGCGGCGCGGCGGCGGGGG - Intronic
1160909925 19:1469671-1469693 GCCGCGCGCCGCAGCAGCGACGG + Exonic
1160967784 19:1754125-1754147 GCCGCCAGACGCTGCGGCGGGGG - Exonic
1162021159 19:7869235-7869257 GCCGCGGGCGGCAGCGGCGGGGG - Exonic
1162022569 19:7874388-7874410 GCTGCGGGCTGCGGCGCCGGGGG + Exonic
1162739887 19:12767832-12767854 GCTGCGCCCAGCTGCAGCCGCGG - Exonic
1162927132 19:13936274-13936296 GCTGCCCGCAGATGGGGCGGGGG + Intronic
1163715219 19:18869250-18869272 GCTGCGTTTCGCGGCGGCGGCGG - Exonic
1163743892 19:19033489-19033511 GCCTCGCGCGGCGGCGGCGGCGG - Intronic
1163807247 19:19406442-19406464 GCTGAACCCCGCGGCGGCGGCGG + Intronic
1164995850 19:32720144-32720166 GCTGTGCGCGGCTGGGGTGGGGG - Intronic
1165311218 19:35030457-35030479 CCTGCGCACTGCAGCGGCGGCGG - Intergenic
1165850859 19:38849701-38849723 GCGGCGGGCGGCGGCGGCGGTGG - Exonic
1167633491 19:50639823-50639845 GGCGCGCGGGGCTGCGGCGGCGG - Intronic
926090027 2:10043623-10043645 GCTGCGGGCGGCGGCGGCGGCGG - Exonic
926154899 2:10448288-10448310 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
928303689 2:30147850-30147872 GCAGAGCGCGGCGGCGGCGGTGG - Intronic
929218040 2:39436857-39436879 GCCGCGCGCCGCCGAGGCCGTGG - Intronic
929468618 2:42169312-42169334 GCTGCGCGCGGGCGCGGGGGCGG + Intergenic
931614618 2:64143934-64143956 CCTGCGCGCCCCCGCTGCGGCGG - Intronic
935112321 2:100104812-100104834 GCAGAGCACCGCGGCGGCGGCGG - Intronic
935592437 2:104855284-104855306 GCCGGGGGCCGCGGCGGCGGCGG + Intergenic
938407358 2:131039936-131039958 GGTTCCCGCCGCTGCGGCGCAGG + Intronic
939153802 2:138501750-138501772 CGTGCGCGCGGCGGCGGCGGCGG - Intergenic
939900503 2:147844598-147844620 GCGGCGGGCGGCAGCGGCGGCGG - Exonic
942276303 2:174326455-174326477 GCTGCTCCCCGCAGCTGCGGAGG + Intergenic
944831214 2:203535334-203535356 GCAGCGCCCCGCGGCGGCGGCGG + Exonic
945699413 2:213151713-213151735 GCTGGCGGCGGCTGCGGCGGCGG + Intronic
946865658 2:224039289-224039311 GCTGGCTGCCGCGGCGGCGGGGG + Intronic
947741679 2:232487641-232487663 GCTCCGCGCAGTGGCGGCGGCGG + Intronic
948349465 2:237326754-237326776 GCTGCTCACAGCTGCGGAGGTGG + Intronic
1168883255 20:1225644-1225666 ACTGGGCGCGGCGGCGGCGGCGG - Intergenic
1171974830 20:31587859-31587881 GCGGCGCGCAGATGGGGCGGGGG - Intergenic
1171977593 20:31605413-31605435 GCTGGGGCCCGCGGCGGCGGTGG - Exonic
1173672933 20:44810487-44810509 GCTGCTGGCGGCGGCGGCGGCGG + Intergenic
1174204250 20:48827768-48827790 GCTGGGCGCCGCGGCGCCAGGGG + Exonic
1175562306 20:59940436-59940458 GCTGCGGCGCGCTGCGGCAGGGG - Intronic
1176550164 21:8217357-8217379 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176569092 21:8400392-8400414 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176577006 21:8444627-8444649 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176867561 21:14062698-14062720 GCTGCCCGCAGCAGCGGGGGGGG + Intergenic
1180042859 21:45288712-45288734 GCTGCGGGGAGCGGCGGCGGCGG - Intergenic
1180609482 22:17085906-17085928 GCTTCGCGCCTCTGGGGAGGTGG - Intronic
1180961936 22:19766182-19766204 TCTGCGGGCGGCGGCGGCGGCGG - Intronic
1181051020 22:20238309-20238331 GGGGCGGGCCACTGCGGCGGCGG - Intergenic
1181053760 22:20249710-20249732 TCTGCATGCCGCTGCGGCAGAGG + Intronic
1181510857 22:23388221-23388243 ACAGGGCGCGGCTGCGGCGGGGG - Intergenic
1182532295 22:30969614-30969636 GCTCCGCCCCGCTCCGGGGGAGG + Intergenic
1183524934 22:38317293-38317315 GCGGAGCGCGGCGGCGGCGGCGG - Exonic
1183607325 22:38873128-38873150 GCTTCGCGCAGCTGCGGGCGGGG - Intergenic
1183702241 22:39457296-39457318 GCTGCACCCCGGGGCGGCGGCGG - Intergenic
1184386124 22:44175658-44175680 GCTGTGTGCCGCTGAGGCGTTGG + Intronic
1184673359 22:46027380-46027402 GCCGCGCCCCGCCGCGCCGGGGG + Intergenic
1185158588 22:49208923-49208945 GCTTCGCGGCTCTGCAGCGGGGG - Intergenic
1185374288 22:50474956-50474978 GGTTCGCTCCGCGGCGGCGGCGG + Exonic
1203255057 22_KI270733v1_random:133689-133711 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1203263113 22_KI270733v1_random:178768-178790 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
951080468 3:18445299-18445321 GCGGTGCGCAGCAGCGGCGGCGG - Intronic
951558696 3:23945497-23945519 GCGGCGCGGCGCTGAGGCGGCGG + Exonic
954004225 3:47578883-47578905 GCTGAGCGCAGCGGCGGCAGCGG - Exonic
954392199 3:50273705-50273727 GCACAGCCCCGCTGCGGCGGGGG - Intronic
955916480 3:63912634-63912656 GCCGCGCCGCGCGGCGGCGGCGG + Exonic
955916482 3:63912637-63912659 GCGCCGCGCGGCGGCGGCGGCGG + Exonic
956818306 3:72928992-72929014 GCTGCGCGGCGCTGGAGCGGCGG - Intronic
961213275 3:125141696-125141718 GCTGCGGGCTGCTGCCGCGGCGG + Intronic
961251567 3:125510745-125510767 GCTGCCAGCAGCTGCGGCAGGGG + Intronic
961305969 3:125959284-125959306 GCTGCCGGCCCCTGCGGCCGTGG + Intergenic
961703425 3:128765048-128765070 GCTGCGCGGCGCTGGAGCGGCGG + Intronic
962751120 3:138435295-138435317 GCTGCGCGCCGCGGGAGGGGCGG - Intronic
964482783 3:157159580-157159602 GCTGTTCGCAGCGGCGGCGGCGG - Intronic
966878929 3:184338823-184338845 GCTCCGCGCAGCTGCGGCCCAGG - Intronic
967968974 3:194985361-194985383 GCTGCGTTCCGCTGCGGCTCCGG - Intergenic
968136038 3:196220153-196220175 GCTGCGCGCCGGGCTGGCGGAGG + Intronic
977257645 4:94758261-94758283 GCTGCGCGGCCGTGGGGCGGTGG + Intronic
978072623 4:104491551-104491573 GATGCGCGCGGCGGCCGCGGCGG + Exonic
978621031 4:110634238-110634260 GCTGCCCGGCGCTGTGGCGTGGG + Intronic
980405031 4:132344804-132344826 GCTGTGCGGGGCTGCGGCTGGGG + Intergenic
980405056 4:132344883-132344905 GCTGTGCGGGGCTGCGGCTGGGG + Intergenic
980969410 4:139555621-139555643 TCTGCGCCCCGCGGCGGCCGCGG - Intronic
981044615 4:140253355-140253377 GCTGCTCGGGGCTGCTGCGGCGG + Intergenic
984462991 4:180059156-180059178 CCTGCGCCCGGCCGCGGCGGCGG + Intergenic
984795731 4:183658879-183658901 GCTGCGCGCCGCGCCCGCGCTGG + Intronic
985541877 5:491203-491225 GATGCCCGCCGCTGCTGCCGGGG - Intronic
986330468 5:6713481-6713503 GCTCGGCGCTCCTGCGGCGGCGG - Intergenic
989368322 5:40680073-40680095 GCTGCCCGTGGCTGGGGCGGAGG + Exonic
989812668 5:45696204-45696226 GCTGCCCGTCGCGGCGGCGGCGG + Intergenic
991371619 5:65925722-65925744 GCGCCGCGACTCTGCGGCGGGGG - Intergenic
992940036 5:81751830-81751852 CCTCGGCGCCGCTGCGGTGGCGG + Intergenic
993901217 5:93585108-93585130 GCGGCCCGCGGCGGCGGCGGCGG + Exonic
995224954 5:109690754-109690776 GCGGCGTGCGGCGGCGGCGGCGG + Intronic
996862812 5:128084227-128084249 GCGGGCCGCTGCTGCGGCGGCGG + Exonic
1001824989 5:174737369-174737391 GGGGCGAGCCGCTGAGGCGGTGG - Intergenic
1002352039 5:178590124-178590146 GCGGCGGGCGGCGGCGGCGGAGG - Exonic
1002487703 5:179550821-179550843 GCTGCGCGCGGCCGCGGGGCTGG + Exonic
1003325309 6:5086022-5086044 GCTGCTGGCCGCGGCGGCAGTGG + Exonic
1003603970 6:7542638-7542660 GCTGCGCGTCCCGGCGGCGCGGG + Intronic
1004690289 6:17987533-17987555 GGGGCGCGCGGCTGCAGCGGCGG - Exonic
1004690340 6:17987677-17987699 GCGGGGCGCGGCGGCGGCGGCGG + Intergenic
1005385200 6:25279126-25279148 GCTGTGCGGTGCTGCGGTGGCGG - Intronic
1007032324 6:38639713-38639735 GGTGCGCGCGGATACGGCGGGGG + Intronic
1007585165 6:42984836-42984858 GCTGCCAGCCGCGGGGGCGGAGG - Intronic
1007644436 6:43369467-43369489 GCTGCGCGCCGCCTCAGCCGCGG + Intronic
1007902063 6:45422094-45422116 GCGGCGCGGCGCGGCGGTGGCGG + Intronic
1008387744 6:50913293-50913315 GCTGCGTGGCGCTGGAGCGGCGG + Intergenic
1008673317 6:53794984-53795006 GCTCCGCGCGGCGGCGGGGGCGG + Exonic
1010198507 6:73263213-73263235 GAAGCGCGCGGCTGCGGCGCGGG + Intronic
1013273406 6:108561608-108561630 GCCGCCCCCGGCTGCGGCGGTGG - Exonic
1015799207 6:137044234-137044256 CCTCCGCGCGGCCGCGGCGGTGG + Intronic
1015994932 6:138987901-138987923 CCGGCGCGCGGCTGCGGCTGCGG + Exonic
1017164213 6:151391765-151391787 GCTGCAGGCGGCGGCGGCGGCGG - Intergenic
1017672008 6:156777809-156777831 GGCGCGCGGCGCGGCGGCGGCGG + Intergenic
1018613156 6:165662537-165662559 TCTGCGCGCGGCGGCGGCTGCGG - Intronic
1020204567 7:6104972-6104994 GCTGTGTGCGGCGGCGGCGGCGG + Exonic
1021600221 7:22356985-22357007 CCTGGCCGCCGCGGCGGCGGTGG - Intronic
1025069777 7:55887834-55887856 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069786 7:55887857-55887879 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069795 7:55887882-55887904 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025261771 7:57424986-57425008 GCAGGGCGCCGCCTCGGCGGGGG - Intergenic
1029168932 7:98617438-98617460 GCTGAGCGCGGCAGCGGCGGCGG + Exonic
1031406912 7:121396535-121396557 GCGCAGGGCCGCTGCGGCGGCGG - Intergenic
1031990149 7:128192411-128192433 GCTGCGCGCAGCTGCTGGGAAGG - Intergenic
1032525706 7:132577096-132577118 GAGGCGCGGGGCTGCGGCGGTGG + Exonic
1033361338 7:140640721-140640743 GAAGCGCGCCGCTGGGGCCGGGG - Exonic
1034223003 7:149460194-149460216 GCCGCGCGCAGTAGCGGCGGCGG - Intronic
1034494288 7:151410547-151410569 GGTGCGAGCCGCTGCGGGGTCGG + Intronic
1037807558 8:22066974-22066996 GCTGCGCGGCGCTGCGCGGCGGG - Intronic
1038017731 8:23529349-23529371 GCTGCGCGCAGCTGCTCCTGGGG - Intronic
1039454399 8:37697670-37697692 GCCGTGAGCCGCGGCGGCGGTGG + Exonic
1044115268 8:88327583-88327605 GCTGGGGGCGGCGGCGGCGGCGG - Intronic
1045222573 8:100213250-100213272 ACGGCGGGCCTCTGCGGCGGCGG + Exonic
1045459384 8:102412724-102412746 GCTCCGCTCCGGAGCGGCGGGGG + Exonic
1045547357 8:103140752-103140774 GCTCCGCGCGGCTGCAGCGCGGG + Exonic
1049051513 8:140200531-140200553 GGTGGGCACCCCTGCGGCGGCGG + Intronic
1049670045 8:143865349-143865371 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
1049682062 8:143923673-143923695 GCTGCGCGGCGAGGCGGAGGCGG - Exonic
1049759846 8:144326996-144327018 GCTCTGCGCCGGTGCGGCCGCGG - Intergenic
1050377215 9:4985418-4985440 GCTGAGGGCTGCTGCGGCGCAGG + Exonic
1050437762 9:5628593-5628615 GCTGCCGGCCGCTGTGGCTGTGG - Intergenic
1051289115 9:15527717-15527739 GCTGCGCGGCGCTGGAGCTGCGG + Intergenic
1057488543 9:95505858-95505880 GCAGCGCGGGGCTGCGGAGGCGG - Intronic
1057900410 9:98943917-98943939 GCGGCGCTCGGCAGCGGCGGCGG - Exonic
1059145591 9:111896814-111896836 AGTGCGCGGAGCTGCGGCGGTGG + Exonic
1059296487 9:113275585-113275607 GCTCCGCGCCGCTCCGGGGGCGG + Exonic
1059769885 9:117414957-117414979 GCTGCGGGCGGCGGCGGCGGTGG + Exonic
1060599588 9:124869150-124869172 GCTGCGCGCGGAGGCGGTGGAGG + Exonic
1061522231 9:131125593-131125615 ACTGCGCGCCGCTGGCGCTGAGG + Exonic
1061975713 9:134067356-134067378 GCCGCGCGCCGCGGCCGGGGCGG - Intronic
1062372179 9:136245668-136245690 GCTGCTAGCGGCGGCGGCGGTGG - Exonic
1062479622 9:136745295-136745317 GCTGCCCTCCCCTGAGGCGGGGG - Intronic
1062579178 9:137222010-137222032 GCCGCGCGCCGCCGCCGCAGAGG + Intergenic
1062624183 9:137435530-137435552 GCTGGGCCCAGCTGCGGCCGTGG + Intronic
1203471457 Un_GL000220v1:116829-116851 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1203479278 Un_GL000220v1:160801-160823 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1189310022 X:40012425-40012447 TCTGCCCGCAGCTGCCGCGGAGG + Intergenic
1193130095 X:77910648-77910670 GCGGCTGGCCGCCGCGGCGGGGG + Intronic
1193654993 X:84187997-84188019 GCTGGGGGTCGCGGCGGCGGCGG - Intergenic
1199458068 X:148052159-148052181 GCTGCGCGGCCCTGGAGCGGCGG - Intergenic
1199815954 X:151397097-151397119 GCGGCGCGCCGCAGCGACGCAGG - Intronic
1200000277 X:153056562-153056584 GCTATGCGCGGCGGCGGCGGCGG - Intronic
1200003195 X:153072530-153072552 GCTGCGCGCCGCTGCGGCGGCGG - Exonic
1200004528 X:153077479-153077501 GCTGCGCGCCGCTGCGGCGGCGG + Intergenic
1200173765 X:154097636-154097658 GCTCGGCGCGGCGGCGGCGGCGG + Exonic
1201416392 Y:13752440-13752462 GCTGCGCCCAGCTGCGCCCGGGG + Intergenic