ID: 1200004279

View in Genome Browser
Species Human (GRCh38)
Location X:153076699-153076721
Sequence GTTCCACGGGCCCCCAGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200004270_1200004279 18 Left 1200004270 X:153076658-153076680 CCGAGAAACTCCTCGCCTGAGCA No data
Right 1200004279 X:153076699-153076721 GTTCCACGGGCCCCCAGTGCCGG No data
1200004275_1200004279 3 Left 1200004275 X:153076673-153076695 CCTGAGCAACGGGGCACAAAGAC No data
Right 1200004279 X:153076699-153076721 GTTCCACGGGCCCCCAGTGCCGG No data
1200004269_1200004279 24 Left 1200004269 X:153076652-153076674 CCGAGACCGAGAAACTCCTCGCC No data
Right 1200004279 X:153076699-153076721 GTTCCACGGGCCCCCAGTGCCGG No data
1200004274_1200004279 8 Left 1200004274 X:153076668-153076690 CCTCGCCTGAGCAACGGGGCACA No data
Right 1200004279 X:153076699-153076721 GTTCCACGGGCCCCCAGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200004279 Original CRISPR GTTCCACGGGCCCCCAGTGC CGG Intergenic
No off target data available for this crispr