ID: 1200004662

View in Genome Browser
Species Human (GRCh38)
Location X:153077935-153077957
Sequence CCCGCACGTGCCCCGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200004652_1200004662 10 Left 1200004652 X:153077902-153077924 CCACAGCGGTTCCTGGTCCAGGC No data
Right 1200004662 X:153077935-153077957 CCCGCACGTGCCCCGGAGGCAGG No data
1200004647_1200004662 29 Left 1200004647 X:153077883-153077905 CCAGCGCCTTTGGCTCTCACCAC No data
Right 1200004662 X:153077935-153077957 CCCGCACGTGCCCCGGAGGCAGG No data
1200004649_1200004662 23 Left 1200004649 X:153077889-153077911 CCTTTGGCTCTCACCACAGCGGT No data
Right 1200004662 X:153077935-153077957 CCCGCACGTGCCCCGGAGGCAGG No data
1200004653_1200004662 -1 Left 1200004653 X:153077913-153077935 CCTGGTCCAGGCCTCTGCCCCTC No data
Right 1200004662 X:153077935-153077957 CCCGCACGTGCCCCGGAGGCAGG No data
1200004654_1200004662 -7 Left 1200004654 X:153077919-153077941 CCAGGCCTCTGCCCCTCCCGCAC No data
Right 1200004662 X:153077935-153077957 CCCGCACGTGCCCCGGAGGCAGG No data
1200004646_1200004662 30 Left 1200004646 X:153077882-153077904 CCCAGCGCCTTTGGCTCTCACCA No data
Right 1200004662 X:153077935-153077957 CCCGCACGTGCCCCGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200004662 Original CRISPR CCCGCACGTGCCCCGGAGGC AGG Intergenic
No off target data available for this crispr