ID: 1200005364

View in Genome Browser
Species Human (GRCh38)
Location X:153081374-153081396
Sequence TTCAGCTGGCCCCAAAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200005352_1200005364 22 Left 1200005352 X:153081329-153081351 CCATGCCCCCAGCTCCTCTCACC No data
Right 1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG No data
1200005359_1200005364 1 Left 1200005359 X:153081350-153081372 CCACATTCCTGCCGATCTGGCCT No data
Right 1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG No data
1200005360_1200005364 -6 Left 1200005360 X:153081357-153081379 CCTGCCGATCTGGCCTGTTCAGC No data
Right 1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG No data
1200005353_1200005364 17 Left 1200005353 X:153081334-153081356 CCCCCAGCTCCTCTCACCACATT No data
Right 1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG No data
1200005362_1200005364 -10 Left 1200005362 X:153081361-153081383 CCGATCTGGCCTGTTCAGCTGGC No data
Right 1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG No data
1200005357_1200005364 8 Left 1200005357 X:153081343-153081365 CCTCTCACCACATTCCTGCCGAT No data
Right 1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG No data
1200005351_1200005364 30 Left 1200005351 X:153081321-153081343 CCATGTTGCCATGCCCCCAGCTC No data
Right 1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG No data
1200005355_1200005364 15 Left 1200005355 X:153081336-153081358 CCCAGCTCCTCTCACCACATTCC No data
Right 1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG No data
1200005356_1200005364 14 Left 1200005356 X:153081337-153081359 CCAGCTCCTCTCACCACATTCCT No data
Right 1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG No data
1200005354_1200005364 16 Left 1200005354 X:153081335-153081357 CCCCAGCTCCTCTCACCACATTC No data
Right 1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200005364 Original CRISPR TTCAGCTGGCCCCAAAGCAC AGG Intergenic
No off target data available for this crispr