ID: 1200011294

View in Genome Browser
Species Human (GRCh38)
Location X:153122909-153122931
Sequence GCATTCAAGTTCCTCTTCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200011294_1200011304 25 Left 1200011294 X:153122909-153122931 CCTTCGAAGAGGAACTTGAATGC No data
Right 1200011304 X:153122957-153122979 CTCAAGCAGGAGCACCCTCGCGG No data
1200011294_1200011300 1 Left 1200011294 X:153122909-153122931 CCTTCGAAGAGGAACTTGAATGC No data
Right 1200011300 X:153122933-153122955 CCGCTTTCCATGGTGCAGGTTGG No data
1200011294_1200011296 -3 Left 1200011294 X:153122909-153122931 CCTTCGAAGAGGAACTTGAATGC No data
Right 1200011296 X:153122929-153122951 TGCCCCGCTTTCCATGGTGCAGG No data
1200011294_1200011295 -9 Left 1200011294 X:153122909-153122931 CCTTCGAAGAGGAACTTGAATGC No data
Right 1200011295 X:153122923-153122945 CTTGAATGCCCCGCTTTCCATGG No data
1200011294_1200011302 12 Left 1200011294 X:153122909-153122931 CCTTCGAAGAGGAACTTGAATGC No data
Right 1200011302 X:153122944-153122966 GGTGCAGGTTGGCCTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200011294 Original CRISPR GCATTCAAGTTCCTCTTCGA AGG (reversed) Intergenic