ID: 1200012871

View in Genome Browser
Species Human (GRCh38)
Location X:153133126-153133148
Sequence CGGCAAATGAGGAGCTACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200012871_1200012878 28 Left 1200012871 X:153133126-153133148 CCATGGTAGCTCCTCATTTGCCG No data
Right 1200012878 X:153133177-153133199 CATCGTACGTTCTTACAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200012871 Original CRISPR CGGCAAATGAGGAGCTACCA TGG (reversed) Intergenic
No off target data available for this crispr