ID: 1200012878

View in Genome Browser
Species Human (GRCh38)
Location X:153133177-153133199
Sequence CATCGTACGTTCTTACAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200012875_1200012878 -6 Left 1200012875 X:153133160-153133182 CCCTCTCCTAATGTATGCATCGT No data
Right 1200012878 X:153133177-153133199 CATCGTACGTTCTTACAATGAGG No data
1200012874_1200012878 8 Left 1200012874 X:153133146-153133168 CCGGCATCAGATTTCCCTCTCCT No data
Right 1200012878 X:153133177-153133199 CATCGTACGTTCTTACAATGAGG No data
1200012873_1200012878 17 Left 1200012873 X:153133137-153133159 CCTCATTTGCCGGCATCAGATTT No data
Right 1200012878 X:153133177-153133199 CATCGTACGTTCTTACAATGAGG No data
1200012870_1200012878 29 Left 1200012870 X:153133125-153133147 CCCATGGTAGCTCCTCATTTGCC No data
Right 1200012878 X:153133177-153133199 CATCGTACGTTCTTACAATGAGG No data
1200012871_1200012878 28 Left 1200012871 X:153133126-153133148 CCATGGTAGCTCCTCATTTGCCG No data
Right 1200012878 X:153133177-153133199 CATCGTACGTTCTTACAATGAGG No data
1200012876_1200012878 -7 Left 1200012876 X:153133161-153133183 CCTCTCCTAATGTATGCATCGTA No data
Right 1200012878 X:153133177-153133199 CATCGTACGTTCTTACAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200012878 Original CRISPR CATCGTACGTTCTTACAATG AGG Intergenic
No off target data available for this crispr