ID: 1200014631

View in Genome Browser
Species Human (GRCh38)
Location X:153149033-153149055
Sequence ACAGCTTAAAAGGGTAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200014631_1200014636 -7 Left 1200014631 X:153149033-153149055 CCTTCCTTACCCTTTTAAGCTGT No data
Right 1200014636 X:153149049-153149071 AAGCTGTTGAGTGAAGTGGATGG No data
1200014631_1200014638 10 Left 1200014631 X:153149033-153149055 CCTTCCTTACCCTTTTAAGCTGT No data
Right 1200014638 X:153149066-153149088 GGATGGTACACACAGTGGTTAGG No data
1200014631_1200014637 5 Left 1200014631 X:153149033-153149055 CCTTCCTTACCCTTTTAAGCTGT No data
Right 1200014637 X:153149061-153149083 GAAGTGGATGGTACACACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200014631 Original CRISPR ACAGCTTAAAAGGGTAAGGA AGG (reversed) Intergenic
No off target data available for this crispr