ID: 1200017055

View in Genome Browser
Species Human (GRCh38)
Location X:153173920-153173942
Sequence CTCACATGGAAGACGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200017055_1200017065 16 Left 1200017055 X:153173920-153173942 CCTTGCCCCGTCTTCCATGTGAG No data
Right 1200017065 X:153173959-153173981 CTGTCTATGAACTGGGAAGCAGG No data
1200017055_1200017063 8 Left 1200017055 X:153173920-153173942 CCTTGCCCCGTCTTCCATGTGAG No data
Right 1200017063 X:153173951-153173973 AAAGAGAGCTGTCTATGAACTGG No data
1200017055_1200017064 9 Left 1200017055 X:153173920-153173942 CCTTGCCCCGTCTTCCATGTGAG No data
Right 1200017064 X:153173952-153173974 AAGAGAGCTGTCTATGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200017055 Original CRISPR CTCACATGGAAGACGGGGCA AGG (reversed) Intergenic
No off target data available for this crispr