ID: 1200023147

View in Genome Browser
Species Human (GRCh38)
Location X:153228780-153228802
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200023147_1200023151 24 Left 1200023147 X:153228780-153228802 CCCAGGTTCAACTGCATGTACAG No data
Right 1200023151 X:153228827-153228849 GTTATCTGCAAAGTACCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200023147 Original CRISPR CTGTACATGCAGTTGAACCT GGG (reversed) Intergenic
No off target data available for this crispr