ID: 1200024970

View in Genome Browser
Species Human (GRCh38)
Location X:153250919-153250941
Sequence ACAGCTTAAAAGGGTAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200024964_1200024970 5 Left 1200024964 X:153250891-153250913 CCACTGTGTGTACCATCCACTTC No data
Right 1200024970 X:153250919-153250941 ACAGCTTAAAAGGGTAAGGAAGG No data
1200024965_1200024970 -7 Left 1200024965 X:153250903-153250925 CCATCCACTTCACTCAACAGCTT No data
Right 1200024970 X:153250919-153250941 ACAGCTTAAAAGGGTAAGGAAGG No data
1200024963_1200024970 10 Left 1200024963 X:153250886-153250908 CCTAACCACTGTGTGTACCATCC No data
Right 1200024970 X:153250919-153250941 ACAGCTTAAAAGGGTAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200024970 Original CRISPR ACAGCTTAAAAGGGTAAGGA AGG Intergenic
No off target data available for this crispr