ID: 1200026730

View in Genome Browser
Species Human (GRCh38)
Location X:153266791-153266813
Sequence CGGCAAATGAGGAGCTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200026723_1200026730 28 Left 1200026723 X:153266740-153266762 CCTCATTGTAAGAACGTACGATG No data
Right 1200026730 X:153266791-153266813 CGGCAAATGAGGAGCTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200026730 Original CRISPR CGGCAAATGAGGAGCTACCA TGG Intergenic
No off target data available for this crispr