ID: 1200028305

View in Genome Browser
Species Human (GRCh38)
Location X:153277013-153277035
Sequence GCATTCAAGTTCCTCTTCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200028303_1200028305 -3 Left 1200028303 X:153276993-153277015 CCTGCACCATGGAAAGCGGGGCA No data
Right 1200028305 X:153277013-153277035 GCATTCAAGTTCCTCTTCGAAGG No data
1200028304_1200028305 -9 Left 1200028304 X:153276999-153277021 CCATGGAAAGCGGGGCATTCAAG No data
Right 1200028305 X:153277013-153277035 GCATTCAAGTTCCTCTTCGAAGG No data
1200028295_1200028305 25 Left 1200028295 X:153276965-153276987 CCGCGAGGGTGCTCCTGCTTGAG No data
Right 1200028305 X:153277013-153277035 GCATTCAAGTTCCTCTTCGAAGG No data
1200028299_1200028305 1 Left 1200028299 X:153276989-153277011 CCAACCTGCACCATGGAAAGCGG No data
Right 1200028305 X:153277013-153277035 GCATTCAAGTTCCTCTTCGAAGG No data
1200028297_1200028305 12 Left 1200028297 X:153276978-153277000 CCTGCTTGAGGCCAACCTGCACC No data
Right 1200028305 X:153277013-153277035 GCATTCAAGTTCCTCTTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200028305 Original CRISPR GCATTCAAGTTCCTCTTCGA AGG Intergenic