ID: 1200033865

View in Genome Browser
Species Human (GRCh38)
Location X:153316025-153316047
Sequence CAGAGCAAGGAGACTTTGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200033865_1200033878 30 Left 1200033865 X:153316025-153316047 CCCGACAAAGTCTCCTTGCTCTG No data
Right 1200033878 X:153316078-153316100 GTACCTCCTTCCAGACTCCCTGG No data
1200033865_1200033874 -2 Left 1200033865 X:153316025-153316047 CCCGACAAAGTCTCCTTGCTCTG No data
Right 1200033874 X:153316046-153316068 TGGGCTGGTGGGGAAGCAACTGG No data
1200033865_1200033875 8 Left 1200033865 X:153316025-153316047 CCCGACAAAGTCTCCTTGCTCTG No data
Right 1200033875 X:153316056-153316078 GGGAAGCAACTGGTTTCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200033865 Original CRISPR CAGAGCAAGGAGACTTTGTC GGG (reversed) Intergenic
No off target data available for this crispr