ID: 1200034134

View in Genome Browser
Species Human (GRCh38)
Location X:153317501-153317523
Sequence GACAGGATGTTGGTTTTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200034134_1200034145 20 Left 1200034134 X:153317501-153317523 CCCATGAAAACCAACATCCTGTC No data
Right 1200034145 X:153317544-153317566 AAGAACCCCACAGGCCTTCAGGG No data
1200034134_1200034141 11 Left 1200034134 X:153317501-153317523 CCCATGAAAACCAACATCCTGTC No data
Right 1200034141 X:153317535-153317557 TGCAGCCCAAAGAACCCCACAGG No data
1200034134_1200034144 19 Left 1200034134 X:153317501-153317523 CCCATGAAAACCAACATCCTGTC No data
Right 1200034144 X:153317543-153317565 AAAGAACCCCACAGGCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200034134 Original CRISPR GACAGGATGTTGGTTTTCAT GGG (reversed) Intergenic