ID: 1200034812

View in Genome Browser
Species Human (GRCh38)
Location X:153320348-153320370
Sequence CTGGGGCTGTGCAGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200034798_1200034812 21 Left 1200034798 X:153320304-153320326 CCTGCAGCTCCTGCTTCACCTGC No data
Right 1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG No data
1200034801_1200034812 3 Left 1200034801 X:153320322-153320344 CCTGCACCTCTGGCCACTGCTTG No data
Right 1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG No data
1200034796_1200034812 30 Left 1200034796 X:153320295-153320317 CCTGCCTCACCTGCAGCTCCTGC No data
Right 1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG No data
1200034797_1200034812 26 Left 1200034797 X:153320299-153320321 CCTCACCTGCAGCTCCTGCTTCA No data
Right 1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG No data
1200034802_1200034812 -3 Left 1200034802 X:153320328-153320350 CCTCTGGCCACTGCTTGCCCCTG No data
Right 1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG No data
1200034806_1200034812 -10 Left 1200034806 X:153320335-153320357 CCACTGCTTGCCCCTGGGGCTGT No data
Right 1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG No data
1200034800_1200034812 12 Left 1200034800 X:153320313-153320335 CCTGCTTCACCTGCACCTCTGGC No data
Right 1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200034812 Original CRISPR CTGGGGCTGTGCAGGGAAAC TGG Intergenic
No off target data available for this crispr