ID: 1200035773

View in Genome Browser
Species Human (GRCh38)
Location X:153328856-153328878
Sequence GACTCACAGTTCCACGTGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200035769_1200035773 16 Left 1200035769 X:153328817-153328839 CCAAGACGAGGTAATTTATAAAG No data
Right 1200035773 X:153328856-153328878 GACTCACAGTTCCACGTGACCGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083
1200035768_1200035773 17 Left 1200035768 X:153328816-153328838 CCCAAGACGAGGTAATTTATAAA No data
Right 1200035773 X:153328856-153328878 GACTCACAGTTCCACGTGACCGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200035773 Original CRISPR GACTCACAGTTCCACGTGAC CGG Intergenic
Too many off-targets to display for this crispr