ID: 1200037940

View in Genome Browser
Species Human (GRCh38)
Location X:153345498-153345520
Sequence CAATCTCCTTTCCCATGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200037936_1200037940 14 Left 1200037936 X:153345461-153345483 CCACTATTCTCATGTCATCTCTG 0: 1
1: 0
2: 0
3: 35
4: 352
Right 1200037940 X:153345498-153345520 CAATCTCCTTTCCCATGAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 156
1200037935_1200037940 17 Left 1200037935 X:153345458-153345480 CCTCCACTATTCTCATGTCATCT 0: 1
1: 0
2: 1
3: 24
4: 213
Right 1200037940 X:153345498-153345520 CAATCTCCTTTCCCATGAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 156
1200037933_1200037940 30 Left 1200037933 X:153345445-153345467 CCTTGCCTATGTTCCTCCACTAT 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1200037940 X:153345498-153345520 CAATCTCCTTTCCCATGAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 156
1200037934_1200037940 25 Left 1200037934 X:153345450-153345472 CCTATGTTCCTCCACTATTCTCA 0: 1
1: 0
2: 1
3: 14
4: 211
Right 1200037940 X:153345498-153345520 CAATCTCCTTTCCCATGAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200037940 Original CRISPR CAATCTCCTTTCCCATGAGC AGG Exonic
900910988 1:5596880-5596902 CAACCTCCTTTCCACTGAGGGGG - Intergenic
902395023 1:16127861-16127883 CCAATTCCTTTCCCACGAGCAGG - Intronic
903075824 1:20765301-20765323 CTATCTCTTTTCCCATGAAAAGG + Intronic
903182595 1:21612555-21612577 CAGTTTCCTCTCCCATAAGCAGG + Intronic
903225511 1:21892381-21892403 CAGTCCCCTTCCCCAGGAGCGGG - Intronic
905392124 1:37643324-37643346 AAACCTCCTTTTCCTTGAGCTGG - Intergenic
906432989 1:45770806-45770828 CCATCTGCTTTCCCAAGATCTGG - Intergenic
906461919 1:46041111-46041133 CCATGTCCTGTCCCATGATCTGG - Exonic
907717918 1:56944900-56944922 CAATATCCTTTCCTATGACATGG - Intronic
910984767 1:92994746-92994768 CCATCCCATTTCCCAGGAGCTGG - Intergenic
912356839 1:109061271-109061293 CCATCCCCTTTCCCATGTGTCGG + Intergenic
916811912 1:168313093-168313115 GAATCTCCCTTCCCACTAGCTGG + Exonic
917741817 1:177968501-177968523 CAATTTCCTTACCCATGAAATGG + Intronic
921095590 1:211884802-211884824 CATCCTCCTTCCCCATCAGCTGG + Intergenic
1064708926 10:18103081-18103103 AAATCTCCTTTCTCATTTGCTGG + Intergenic
1064808752 10:19168277-19168299 CAATCTCCATTGCAAGGAGCAGG + Intronic
1064999966 10:21329477-21329499 AATTCACCTTTCCCATGAGCTGG + Intergenic
1066998230 10:42582980-42583002 CAAACTACCTTCCCATGAGGTGG - Intronic
1070187265 10:74076485-74076507 AAGTCTCCTTTCCCAACAGCAGG - Intronic
1071006636 10:80891005-80891027 CAATCAGATTTCACATGAGCTGG - Intergenic
1071821269 10:89283663-89283685 AAATCTCCTTTCCCTCCAGCAGG + Intronic
1072828606 10:98633818-98633840 GAAGATCCTTTCCCAAGAGCAGG - Intronic
1073575449 10:104618943-104618965 CAATCTCCATTCCAGGGAGCTGG - Intergenic
1077836645 11:5932380-5932402 CCATCTCTTTACCGATGAGCGGG + Intronic
1079246252 11:18754390-18754412 GAATCTCCTTTCCTCCGAGCTGG + Intronic
1080143404 11:28949932-28949954 CAATCTCTTTATCCATCAGCAGG - Intergenic
1081812399 11:45921466-45921488 GAATCTCCCCTCCCATGACCTGG - Intergenic
1085822897 11:79812045-79812067 CAATGGCCTCTCCCATGGGCTGG - Intergenic
1085972109 11:81605474-81605496 CATCTTCCTTTCCCATGAGTTGG - Intergenic
1087240794 11:95775523-95775545 CCATCTCCTTTCCCATTATCTGG + Intronic
1087373162 11:97310595-97310617 CAATCTCTTTTCCTCAGAGCTGG - Intergenic
1088069007 11:105757799-105757821 CCATCACCTTTCCAGTGAGCAGG - Intronic
1089050793 11:115544106-115544128 CATTGTCCTCTCCCATGAGAGGG - Intergenic
1089739292 11:120571376-120571398 CAGTCTCTTTTCCCCTGGGCTGG + Intronic
1091482203 12:844685-844707 CAATCTCCATTCCCATCTTCTGG + Intronic
1092102855 12:5900685-5900707 CAATCCCCTTCCCCATGGGTGGG + Intronic
1092170331 12:6370349-6370371 AAATCTCCTTTCCCTGCAGCTGG + Intronic
1092749697 12:11707284-11707306 CGGGCTCATTTCCCATGAGCAGG + Intronic
1092976321 12:13748489-13748511 CCATCTTCATTCCCCTGAGCTGG - Intronic
1094328921 12:29271531-29271553 CAATCTCCTTTCCAGTGTGTAGG + Intronic
1096023886 12:48344712-48344734 TATTTTCCTTTCCCATGAGCAGG - Exonic
1098700512 12:73618727-73618749 CAACCTACTTTCCAAAGAGCAGG - Intergenic
1101358471 12:104003624-104003646 CTTTCCCCTTTCCCATTAGCTGG + Intronic
1101917942 12:108910756-108910778 TAATCTCCTTTCCAATGAGTGGG - Intergenic
1101952981 12:109190558-109190580 AAATCTCCTGTCCCCAGAGCTGG - Intronic
1101976817 12:109366574-109366596 CAATCTCCTTGCCAAAGAACGGG + Intronic
1105531263 13:21222554-21222576 CACCCTCCATTCCCCTGAGCTGG + Intergenic
1107445206 13:40464442-40464464 CATTCTCCATTCCCAGCAGCAGG + Intergenic
1109703252 13:66054992-66055014 CAATTTACATTCCCATCAGCAGG - Intergenic
1110419174 13:75286055-75286077 CATTCTCCTTTACCTTGAGCTGG + Exonic
1112439740 13:99417012-99417034 CAAGCACCTTTCCCATGCCCTGG + Intergenic
1113558705 13:111258983-111259005 CACTCCCCTTTTCCATAAGCAGG - Intronic
1113948294 13:114057339-114057361 CAAGCTTCATTCCCACGAGCTGG + Intronic
1117401026 14:55358617-55358639 CAAACTCCTTGCCCATGAAGAGG + Intronic
1117556760 14:56894124-56894146 CCATCTCCTTTTCCCAGAGCAGG + Intergenic
1119029457 14:71180397-71180419 CTGCCTCCTTTGCCATGAGCAGG - Intergenic
1119227281 14:72954142-72954164 CATTCTCCTATCCCCTTAGCAGG + Exonic
1122678518 14:103437535-103437557 CAATCTGCCTTCCAAGGAGCTGG + Intronic
1126170784 15:45693616-45693638 CAGTTTTCTTTCCCCTGAGCTGG + Intergenic
1127638902 15:60896922-60896944 AAATTTCCTTTCTCATGAGGTGG + Intronic
1127761952 15:62148239-62148261 CACTCTTCTTTCCAATGAGGAGG + Intergenic
1128375854 15:67075325-67075347 CACTCTGCCTTCCCATGGGCTGG - Intronic
1128405306 15:67331025-67331047 GAATCTCCTCTCCCATTATCTGG - Intronic
1129232277 15:74203394-74203416 CATTCTCCCTCCCCAGGAGCAGG + Intronic
1135798755 16:25472662-25472684 CAGTGTCCTTTCCCATGTCCAGG - Intergenic
1136015625 16:27398863-27398885 CAATCTCCATTCCCATTCCCAGG - Intergenic
1137227820 16:46532064-46532086 TAATATCCTTTACAATGAGCAGG - Intergenic
1137432415 16:48428814-48428836 CATGCTCCTTTCCCAAGTGCTGG - Intronic
1138133329 16:54500677-54500699 CAATCTCCTTGCCTATGGGGAGG + Intergenic
1138658201 16:58502585-58502607 AAATCTCCTTTCCCATTTGGAGG + Intronic
1139085361 16:63578307-63578329 CAATCTTTTTTCCCTTGTGCAGG - Intergenic
1139910814 16:70396386-70396408 CAATCTCCCATCCCCTGAGCAGG - Intronic
1141371674 16:83492724-83492746 CAATCCCCATTGCCATCAGCAGG - Intronic
1142712758 17:1732394-1732416 CCATCTCCTGTCCAATGCGCAGG - Exonic
1143410600 17:6706245-6706267 CTTTCTGCTTCCCCATGAGCTGG + Intronic
1143478936 17:7217720-7217742 CTATCTCCTTTCCCATTATCCGG - Exonic
1143767825 17:9149223-9149245 CAATCTCTTTTCCCTAGAGGTGG - Intronic
1144840988 17:18185507-18185529 CATTCTCCATTCCCAGGAGGGGG + Intronic
1145376707 17:22356396-22356418 TAATCTCTTTTCCCATTAACTGG + Intergenic
1145950275 17:28812026-28812048 GAATCTCCTTACCCATCTGCAGG + Intronic
1149480678 17:57000833-57000855 CTTTCTCCTTCCCCATGTGCAGG + Exonic
1151355797 17:73557789-73557811 TAATTTCCTTTCCCATTAACAGG + Intronic
1151488778 17:74419399-74419421 AAACCTCCTTTCCCAGGAGTTGG + Intergenic
1158693545 18:59683017-59683039 CAATCTCCATTCCCTTGGGTAGG + Intronic
1158801597 18:60917275-60917297 CAATGTCCTTTCTCATGGGTAGG + Intergenic
1160053882 18:75461644-75461666 CTCTCTCCTTTGCCATGAGGAGG - Intergenic
1162440603 19:10689913-10689935 CACGCTGCTTTCCCAAGAGCAGG - Exonic
1166701086 19:44882093-44882115 CTATGTCCTCTCCCATGGGCAGG - Intronic
928417982 2:31112602-31112624 AAATATCCTTTCCAATGAGAAGG - Intronic
930750000 2:54925539-54925561 CATTCTACTTTCCTATGAGTGGG + Intronic
931233010 2:60390147-60390169 CAGTCTCCTTTCCGCTGAGTTGG - Intergenic
931737971 2:65215186-65215208 TAATCTCCTTCCCAATAAGCCGG - Intergenic
934968209 2:98741711-98741733 CAATTTATTTTCCCATTAGCTGG - Intergenic
936369915 2:111895276-111895298 AAATCTTCTATCCCATCAGCTGG - Intergenic
938368942 2:130756650-130756672 CCATCTCCTTGCCCCTGGGCAGG + Intronic
943290078 2:186059343-186059365 CTCTCTCCTTTGCCATCAGCCGG - Intergenic
946299569 2:218814407-218814429 CAATTTCCTTTTCTATGATCCGG - Exonic
946895384 2:224318656-224318678 TTATCTCCTTTCTCATGTGCGGG - Intergenic
947844376 2:233232313-233232335 CAATCCCCTTTCCCCTGAGAGGG - Intronic
948667746 2:239546775-239546797 CAGCCTCCTTGCCCCTGAGCAGG + Intergenic
1168889167 20:1282938-1282960 CACTCCCCTTTCCCGAGAGCAGG - Intronic
1169253982 20:4083329-4083351 CAATCTCCTTCCCCCTGGCCAGG - Intergenic
1170769435 20:19319199-19319221 GACTCTACTGTCCCATGAGCAGG + Intronic
1171275492 20:23853573-23853595 CAATCACCTCTGACATGAGCAGG - Intergenic
1173617926 20:44414887-44414909 CAATCTCCTCACCTATGAGATGG - Intronic
1174526194 20:51173529-51173551 CAATTTCCTTACCTATGAGGTGG + Intergenic
1175342206 20:58240135-58240157 CAGTCTCCATTCTCAAGAGCTGG - Intergenic
1177026026 21:15922860-15922882 CAGTCTCTTTTCCCTTGTGCTGG - Intergenic
1179258395 21:39737584-39737606 CAATATCCTTTATCATAAGCCGG - Intergenic
1184294560 22:43515436-43515458 GAATCTCCCTTCCCATGGGCCGG + Intergenic
951822446 3:26827580-26827602 CAGACTGCTCTCCCATGAGCTGG - Intergenic
955406121 3:58626919-58626941 CAGTCTCCCTTCCCATGACCAGG + Intronic
958943468 3:100338536-100338558 CATCTTCCCTTCCCATGAGCTGG + Intronic
960038237 3:113123211-113123233 AAATCTACTTTCCCATGCACTGG - Intergenic
961340636 3:126214810-126214832 CAATCCACTCTCCCATCAGCAGG - Intergenic
966215382 3:177496727-177496749 AAATGTCCTTTCCCATCAGCTGG - Intergenic
967949306 3:194828674-194828696 CCACCTCCTTTCCCAGCAGCTGG - Intergenic
968426425 4:526464-526486 CCATCTCCTCACCCAGGAGCGGG + Intronic
968674587 4:1870924-1870946 CAAGCTCCTGTCCCGTGAGAGGG - Intergenic
969444715 4:7238055-7238077 CAATGTTCTTTCCGATGCGCTGG + Intronic
970061278 4:12037179-12037201 CAAACTCCTGTCCCATGAAGAGG - Intergenic
971325019 4:25636529-25636551 CACTTTCCTATCCCATGTGCTGG - Intergenic
972323042 4:37990473-37990495 CAAACTCCTTACTCATAAGCGGG - Intronic
977335525 4:95693702-95693724 TTAACTACTTTCCCATGAGCAGG - Intergenic
983890424 4:173024660-173024682 CAACCTCCTTTCCCAGGTTCAGG + Intronic
984861568 4:184244879-184244901 AAATCTCCTTTTTCATGAGGGGG + Intergenic
985264055 4:188141677-188141699 AAATCTCCATTCCCAGGAGGCGG - Intronic
985361149 4:189177474-189177496 CAAGCACCTTCCCCATTAGCTGG - Intergenic
988718970 5:33856792-33856814 CAATCTACATTCCCACCAGCAGG - Intronic
991583772 5:68182492-68182514 CACCCTTCTTTCCCTTGAGCAGG + Intergenic
992849377 5:80790030-80790052 CAATCTACTTTCCTACAAGCAGG - Intronic
997041173 5:130256289-130256311 TAATTTACATTCCCATGAGCAGG + Intergenic
998568969 5:143240036-143240058 GAGTCACCTTTCCCAAGAGCAGG + Intergenic
1000088982 5:157913351-157913373 CTTTCTCCTTTCCAATGAGTTGG + Intergenic
1000168304 5:158677102-158677124 CAATCTCCTTGCCCAGGAGCTGG + Intergenic
1000305099 5:159987481-159987503 CACGCCCCTTTCCCCTGAGCAGG + Intergenic
1003006963 6:2391402-2391424 CAATCTCATTTCTCATGAACGGG + Intergenic
1006675329 6:35758541-35758563 GAATGTTCTTTCCCATGAGCTGG + Intergenic
1007801911 6:44401569-44401591 GAATCTCCATTCCTCTGAGCTGG + Intronic
1009860294 6:69321539-69321561 GAATCTCCTTTTCCATGACGAGG - Intronic
1010186627 6:73151699-73151721 CATTCTCCTTTTACCTGAGCTGG + Intronic
1012535350 6:100289863-100289885 TCATCTCCTTTCCCATGATCTGG + Intergenic
1012605160 6:101149078-101149100 CATTCTTCTTTCCCAAGACCTGG - Intergenic
1016290653 6:142525413-142525435 CCATCTACTTTCCCAGGAGGGGG - Intergenic
1019807962 7:3142589-3142611 CAATCTGCATTCACATCAGCAGG - Intronic
1020185960 7:5959929-5959951 CTATCTTCTTTCTCATGATCAGG + Intronic
1020296957 7:6764833-6764855 CTATCTTCTTTCTCATGATCAGG - Intronic
1020919718 7:14247450-14247472 CAATTTACATTCCCAGGAGCAGG + Intronic
1020920107 7:14252822-14252844 CACTCTTCTTTCCCATGTGGAGG + Intronic
1021853785 7:24833818-24833840 CAATCTCCCTACCCATGAGATGG + Intronic
1022232428 7:28427476-28427498 TAATCTCCTTTCCCTTAGGCTGG + Intronic
1023444738 7:40219595-40219617 CAATCTCCATTCACATGGCCTGG - Intronic
1024176716 7:46847722-46847744 ATATCTCCTATCCCTTGAGCAGG - Intergenic
1026447610 7:70499239-70499261 CCTTCTCCTTTCCCTTCAGCAGG - Intronic
1031010328 7:116519845-116519867 CAATTTCTTCTCCCTTGAGCAGG - Intergenic
1033430059 7:141281049-141281071 CAATATCCCTTCCCAGGAGAGGG - Intronic
1035359580 7:158301958-158301980 CAATCCCCTGTCCCATGAGATGG + Intronic
1035785892 8:2260813-2260835 CAAGCACCTTTCCCACGACCTGG + Intergenic
1035806915 8:2460903-2460925 CAAGCACCTTTCCCACGACCTGG - Intergenic
1036222265 8:6930728-6930750 AAACCACCTTTCTCATGAGCCGG + Intergenic
1042950617 8:74197861-74197883 CAAAGCCCTTCCCCATGAGCCGG + Intergenic
1045382846 8:101644158-101644180 CAAACTCCTCTTCCATGGGCCGG - Exonic
1045670953 8:104552971-104552993 CAAGTTCTTTTCCCATGATCTGG - Intronic
1045922892 8:107553263-107553285 CCATCTCATTTCCACTGAGCAGG - Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1057227109 9:93298195-93298217 GAATCTCCTTTCCCTGGAGCAGG + Intronic
1059941953 9:119368098-119368120 CTTTCTCCTTTCCCCTGAGGGGG + Intronic
1060526070 9:124322003-124322025 CAAGATGCTTTCCCAAGAGCTGG - Intronic
1062304272 9:135894185-135894207 CACTCTCCTTCCCCATCAGGCGG + Intronic
1189248367 X:39580877-39580899 CAGACTCCTTTCCCTTCAGCTGG + Intergenic
1189886737 X:45554176-45554198 AAATCCCCCTTCCCATGAGCTGG + Intergenic
1192126255 X:68503399-68503421 CCCTCCCCTTTCCCATCAGCAGG - Intronic
1193224129 X:78961498-78961520 CACTCTCCTTGCTCATGAGGCGG - Exonic
1193265406 X:79463192-79463214 CAAACTCCTTTCACCAGAGCTGG + Intergenic
1194167335 X:90534315-90534337 CACTCTCATTTTCCTTGAGCTGG - Intergenic
1200037940 X:153345498-153345520 CAATCTCCTTTCCCATGAGCAGG + Exonic