ID: 1200039227

View in Genome Browser
Species Human (GRCh38)
Location X:153353721-153353743
Sequence AGCCAATGCCTGCCCCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200039219_1200039227 -5 Left 1200039219 X:153353703-153353725 CCCGGTGCGTCCACCCCCAGCCA 0: 1
1: 0
2: 3
3: 17
4: 260
Right 1200039227 X:153353721-153353743 AGCCAATGCCTGCCCCGGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 196
1200039218_1200039227 -2 Left 1200039218 X:153353700-153353722 CCTCCCGGTGCGTCCACCCCCAG 0: 1
1: 0
2: 5
3: 10
4: 199
Right 1200039227 X:153353721-153353743 AGCCAATGCCTGCCCCGGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 196
1200039215_1200039227 18 Left 1200039215 X:153353680-153353702 CCTACTTAGCAAGGCAGCCACCT 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1200039227 X:153353721-153353743 AGCCAATGCCTGCCCCGGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 196
1200039217_1200039227 1 Left 1200039217 X:153353697-153353719 CCACCTCCCGGTGCGTCCACCCC 0: 1
1: 0
2: 2
3: 21
4: 302
Right 1200039227 X:153353721-153353743 AGCCAATGCCTGCCCCGGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 196
1200039220_1200039227 -6 Left 1200039220 X:153353704-153353726 CCGGTGCGTCCACCCCCAGCCAA 0: 1
1: 0
2: 1
3: 24
4: 508
Right 1200039227 X:153353721-153353743 AGCCAATGCCTGCCCCGGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200039227 Original CRISPR AGCCAATGCCTGCCCCGGCC TGG Intronic
900606598 1:3526325-3526347 TGCCCATGTCTGCCCTGGCCTGG - Intronic
900700675 1:4046994-4047016 AGCCACTTCCTGCCCCCACCAGG + Intergenic
900923026 1:5685637-5685659 GCCCAGTGCCTGGCCCGGCCCGG - Intergenic
900923576 1:5689292-5689314 AGACACTGCCTGTCCTGGCCTGG - Intergenic
901490279 1:9593175-9593197 AGCCTATGCTTGCCTCTGCCCGG - Intronic
903014728 1:20354453-20354475 GGCCAGTGCCTGCCCCCGTCTGG + Intronic
903270684 1:22186334-22186356 AGGGAAAGCCTGCCCTGGCCTGG - Intergenic
904359453 1:29962587-29962609 AGCCCATCCCTGCCCAGGGCTGG + Intergenic
906509380 1:46402213-46402235 AGCCAAGGCCAGCCCCTCCCTGG + Intronic
906543705 1:46607079-46607101 AGCCAATGCCAGGCCAGGCGTGG + Intronic
908612822 1:65881358-65881380 ACCCCATGGCTGCCCCAGCCAGG - Intronic
913086858 1:115446937-115446959 AGCCAATGCCTGCCTGTGCCAGG + Intergenic
913217257 1:116630991-116631013 ACCCTATCCCTGCCCTGGCCTGG - Intronic
914373385 1:147050778-147050800 AGCCCGCGCCTCCCCCGGCCTGG - Intergenic
918109165 1:181440738-181440760 ATCCAAGGCCTACCCCAGCCTGG - Intronic
918301175 1:183205190-183205212 AGCCAATGCCCTCCCTGCCCTGG - Intronic
919455376 1:197814757-197814779 GGCCAAAGCCTGTCCCGGACTGG + Intergenic
920952122 1:210582317-210582339 AGCAACTGCCTGCCCCAGCCCGG + Intronic
922218840 1:223542546-223542568 GGCCAATGCCTCCCCCTGCCTGG + Intronic
922729430 1:227942109-227942131 CCCCAGTGCCTGCCCTGGCCTGG - Intronic
922739355 1:228006855-228006877 TGCCCCTGCCTGCCCCGCCCGGG + Intergenic
1062855257 10:776953-776975 GGCCCATGGCAGCCCCGGCCCGG + Intergenic
1063286697 10:4696132-4696154 ATCCAATGCCTGCACCAGGCTGG - Intergenic
1065342682 10:24722709-24722731 AGCCCACGCCGGCCCCAGCCAGG - Intronic
1067043478 10:42970775-42970797 AGCCTCTGCCGGCCCAGGCCTGG - Intergenic
1067781038 10:49207716-49207738 ACTCAATGCCTGCCCCTGGCAGG + Intergenic
1069673738 10:70232847-70232869 AGTCACTGCCCCCCCCGGCCCGG + Intronic
1070282365 10:75059025-75059047 AGGCCATACCTGCCCGGGCCTGG + Intergenic
1070791175 10:79190261-79190283 TGCTGATGCCTGCCCAGGCCAGG - Intronic
1072619976 10:97073457-97073479 AGCCAGGGCCTGTCCCAGCCCGG + Intronic
1073193863 10:101672224-101672246 AGCCAGGGCCTGCACAGGCCTGG - Intronic
1074008943 10:109457051-109457073 AGCCTACGCCTGCCCCGCCGCGG - Intergenic
1074882416 10:117669271-117669293 TGCAAATGTCTGGCCCGGCCTGG + Intergenic
1075016732 10:118915172-118915194 TGCCACTGCCTGCCCAGGGCAGG + Intergenic
1075742339 10:124703536-124703558 CGTCAGTGCCTGGCCCGGCCTGG - Intronic
1076599826 10:131650349-131650371 AGTCAGTTCCTGGCCCGGCCTGG - Intergenic
1076680281 10:132168171-132168193 AGCCAAGGCCAGGCCCGTCCCGG - Exonic
1076898826 10:133327110-133327132 AGCCACTGGCTGCCCAGGGCGGG - Intronic
1077151209 11:1073904-1073926 CACCACTGCTTGCCCCGGCCCGG - Intergenic
1077286336 11:1767662-1767684 AGCCCTTGCCTGCCCCTGCTAGG + Intergenic
1078134913 11:8643751-8643773 AGACAATGCCTGCCCCCACTAGG - Intronic
1078461427 11:11517985-11518007 CGCCAGTGCCTACCCTGGCCTGG + Intronic
1078865001 11:15289115-15289137 AGCCAATTACTGGCCCAGCCTGG - Intergenic
1081663183 11:44900988-44901010 AAACAATGCCTTCCTCGGCCGGG - Intronic
1082787526 11:57324944-57324966 AGCCACTGCGAGCCCCGGCGGGG + Intronic
1084275952 11:68051088-68051110 AGCAAATGTCTTCCCAGGCCGGG + Intergenic
1084660769 11:70545066-70545088 GGCCCTTGCCTGCCCTGGCCTGG - Intronic
1084961857 11:72721069-72721091 AGCCCAGGCCTGGCCTGGCCTGG + Intronic
1088556414 11:111065733-111065755 AGCCAATCCCTGCCACAGGCAGG + Intergenic
1089622149 11:119728419-119728441 ATCCAATGCCTCCCCGGGGCTGG - Intronic
1089764200 11:120751214-120751236 AGGCTCTGCCTGCCCCTGCCAGG - Intronic
1090406162 11:126476797-126476819 CGCCACTGCCTGGCCCAGCCTGG - Intronic
1091403488 12:195150-195172 AGGCAAAGCCTGCCCCTGGCTGG + Intronic
1101922009 12:108940833-108940855 AGCCAACGCCAGCCCAGGCTGGG + Exonic
1104512502 12:129393314-129393336 AGCCAATGCTTGCCCTATCCAGG + Intronic
1104840729 12:131824094-131824116 ACCCTATGCCAGCCCCAGCCTGG - Intergenic
1105830671 13:24160961-24160983 AGCCCATGCCCGCGCCCGCCCGG - Intronic
1106409689 13:29502738-29502760 AGCCAGTGCCTCCCCTGACCGGG + Intronic
1108470400 13:50761575-50761597 ATCCAATGCCTGCACCAACCAGG + Intronic
1111220857 13:85204864-85204886 AGCCGGTGCCGGCCTCGGCCAGG - Intergenic
1114455581 14:22851264-22851286 TGCCAGTGACTGCCCTGGCCAGG - Intergenic
1117631875 14:57702123-57702145 AGCCACTGCCTGTCCCACCCTGG + Intronic
1118721397 14:68596835-68596857 TGCCAATGTCTGCCCCTGACGGG - Intronic
1118822999 14:69357285-69357307 AGGCAATGCCTGCCTCAGGCTGG + Intergenic
1119539270 14:75428125-75428147 TGCCCAGGCCTGTCCCGGCCCGG - Intronic
1123019211 14:105389772-105389794 AACCACTGCCAGCCCTGGCCTGG - Intronic
1123180109 14:106461190-106461212 AGCCCCTGCCTGCCCGCGCCTGG - Intergenic
1125762203 15:42104284-42104306 AGCCAGGGCCTGCCCCGACCTGG + Intergenic
1129413201 15:75361027-75361049 AGCCAAGGCCTGGCCTGACCTGG + Exonic
1130337937 15:82973773-82973795 AGCCAATGTCTGGCCAGGCATGG + Intronic
1132783401 16:1641367-1641389 AGCCTGTGCCTGCCCCGGGGAGG + Intronic
1132881886 16:2165948-2165970 AGCCAAGGCCAGCCCAGGCTGGG + Intronic
1132886665 16:2185225-2185247 GGCCAGTGCCGGCCCCTGCCTGG + Intronic
1133287228 16:4696260-4696282 AGCCCATGCCTGGCCCGGTGAGG + Intergenic
1135382826 16:22008424-22008446 AGCCAATCCCCCGCCCGGCCCGG - Intronic
1135514731 16:23121445-23121467 AGCCTAGGCCTGGCCTGGCCCGG + Intronic
1136539606 16:30922095-30922117 AGCGAATCCCCGCCCCGCCCCGG - Intergenic
1138316167 16:56072291-56072313 AGGCAATGCCTGCCTTGGCGTGG + Intergenic
1138476579 16:57273744-57273766 GACCAATGCCTGTCCCTGCCAGG + Intronic
1138566410 16:57836406-57836428 AGAAAATGCCTGCACTGGCCAGG - Intronic
1139371724 16:66473285-66473307 AGCCAAGGCCTGACCCCGCTTGG - Intronic
1139708044 16:68755539-68755561 AGAAAATGCCTGGCCTGGCCGGG - Intronic
1141950007 16:87334059-87334081 AGCCAAGCCCTGCCCAGCCCAGG - Exonic
1142089507 16:88202545-88202567 AGCCAGCACCTGCCCCGCCCTGG - Intergenic
1142211535 16:88810940-88810962 AGGGAAACCCTGCCCCGGCCTGG + Intronic
1142355574 16:89600052-89600074 AGCCCCTGCCTGGCCAGGCCTGG - Intergenic
1143364067 17:6394251-6394273 CACCACTGCCTGCCCCTGCCAGG - Intronic
1147211247 17:38873759-38873781 AGGCAATGCCAGCCCCACCCTGG - Intronic
1147918126 17:43900614-43900636 AGCCAAAGCCTGGCCGGGCTGGG + Intronic
1148779371 17:50112847-50112869 AGCCAGTGGCTGCCCCTGCCGGG + Exonic
1151210231 17:72538961-72538983 AGCTAATGCCAGCCCCAGCCCGG + Intergenic
1151313930 17:73310863-73310885 AGCCGGTGAGTGCCCCGGCCGGG - Intronic
1151553574 17:74835589-74835611 AGGCAGTGCCTGCCCAGGACTGG + Intronic
1151678625 17:75612811-75612833 CGCCAGTGGCTGCCCTGGCCTGG - Intergenic
1152357394 17:79813712-79813734 AGACAAAGCCCGCCCCGGGCCGG + Intergenic
1152574067 17:81132550-81132572 CTCCAATCCCAGCCCCGGCCTGG + Intronic
1152641377 17:81450650-81450672 ACCAAATCCCTGCCCCTGCCCGG - Intronic
1152792891 17:82291788-82291810 AGCCCATCCCTGGCCCTGCCTGG - Intergenic
1153900567 18:9614379-9614401 ACCCCACGCCGGCCCCGGCCCGG + Intronic
1156155717 18:34300102-34300124 AGCCAATGCCTGCCCACGGAGGG + Intergenic
1156515936 18:37680327-37680349 AGCCAATGTCTACCATGGCCAGG - Intergenic
1157473829 18:48008906-48008928 AACCAATGCATGCCCTGGTCTGG - Intergenic
1157986370 18:52442846-52442868 AGCCAATGTCTGCAGGGGCCAGG + Intronic
1160036351 18:75305032-75305054 AGCTGCTGCCTGGCCCGGCCTGG + Intergenic
1160745904 19:710482-710504 AGCCACACCCTGCCCAGGCCTGG - Intronic
1160803502 19:980891-980913 AGCCACCGCCTGGCCCAGCCTGG - Intergenic
1160905501 19:1450017-1450039 AGCCAATGGCGGCCCGGGGCGGG - Intronic
1162743124 19:12784158-12784180 AGTCAATGTCTGCCCTGCCCCGG - Intronic
1162935723 19:13980547-13980569 AGCCACTGCCCGCCTTGGCCTGG + Intronic
1164875873 19:31688006-31688028 ACCCCAGGCCTGCACCGGCCAGG + Intergenic
1165383592 19:35497445-35497467 AGCCTGTGCCAGCCCTGGCCCGG - Exonic
1165811491 19:38614459-38614481 ATCCAATGCCTGGCCTGGCCGGG - Intronic
1166673039 19:44722904-44722926 AGCGCATGCCTGACCCAGCCTGG + Intergenic
1168267228 19:55229617-55229639 AGCCAGTGCCTGGCCCAGCCTGG + Intergenic
1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
926003493 2:9353277-9353299 AGCCACTGCCTGGCCCACCCAGG - Intronic
927071605 2:19536446-19536468 TGCCTATCCCTGCCCCGACCTGG + Intergenic
927244056 2:20942650-20942672 AGCCAACGCCTCCCCAGGCCAGG - Intergenic
932101702 2:68907064-68907086 AGCAAATGCCTGCCCTTGCTGGG - Intergenic
932209332 2:69914621-69914643 AGCCAATGCCAGACCCGGTGAGG + Intronic
934219599 2:90070022-90070044 TGCCAATGCCTTCACTGGCCTGG - Intergenic
938074715 2:128325669-128325691 AGCCAATTCCTGCCCTTACCCGG + Intergenic
938080928 2:128369758-128369780 GGACAATGCCTGCCCCTCCCAGG - Intergenic
938207155 2:129433771-129433793 AGCCAATGCCTCTCCCTGGCTGG + Intergenic
938381180 2:130837326-130837348 AGCCGCTGCCTGGACCGGCCTGG + Intronic
938405967 2:131033396-131033418 AACCCCTGCCTGCCCAGGCCTGG + Intronic
940009446 2:149038712-149038734 AGCCAACGCCGGCCCCAGGCGGG + Exonic
942232735 2:173874997-173875019 AGCCAATGCCTGCCTATGCCAGG + Intergenic
944662425 2:201932337-201932359 AGCCACTGGCTGCCCAGGCAAGG - Intergenic
948462964 2:238139083-238139105 CCCCAGTGCCTGCCCAGGCCCGG - Intronic
948592584 2:239060802-239060824 AGCCCGCACCTGCCCCGGCCCGG + Intronic
949037326 2:241821841-241821863 AGCCACTGCCCGGCCCAGCCTGG - Intergenic
1171784407 20:29449125-29449147 AGCCAGGCCCTGCCCCAGCCAGG - Intergenic
1172760337 20:37316986-37317008 AGGCACTGCCTACCCTGGCCTGG - Exonic
1173457508 20:43215410-43215432 AGCCAATGACTGTCCGGTCCAGG + Intergenic
1174046962 20:47740538-47740560 AGGCAATGCCACCCCCTGCCTGG - Intronic
1176023038 20:62972451-62972473 AGCGAATGACCGCCACGGCCAGG - Intergenic
1176131327 20:63497990-63498012 AGCCTCTGCTTGCCCTGGCCAGG - Intronic
1176372202 21:6068909-6068931 AGCCCAGGCCTGCCACGGCGGGG - Intergenic
1179678890 21:43003742-43003764 AGTCAATGCCTGCCCATGCCAGG - Intronic
1179751317 21:43469630-43469652 AGCCCAGGCCTGCCACGGCGGGG + Intergenic
1180818617 22:18809391-18809413 ACCCTATCCCTGCCCTGGCCTGG - Intergenic
1181041125 22:20193127-20193149 AGCCACTGCCTGCCCAGCACTGG + Intergenic
1181204840 22:21243846-21243868 ACCCTATCCCTGCCCTGGCCTGG - Intergenic
1181632644 22:24159329-24159351 AGGCAGTGCCTGACCAGGCCGGG + Intronic
1182101792 22:27662825-27662847 AGCAAATCCCTTCCCCGGCCTGG - Intergenic
1183261918 22:36800658-36800680 AGCCAATGCCTGACCAGGCCTGG + Intergenic
1184421795 22:44386478-44386500 AGCTAATGTCTGTCCCGTCCTGG + Intergenic
1203222085 22_KI270731v1_random:51569-51591 ACCCTATCCCTGCCCTGGCCTGG + Intergenic
1203268746 22_KI270734v1_random:35244-35266 ACCCTATCCCTGCCCTGGCCTGG - Intergenic
950431829 3:12955332-12955354 CGCCAATGCCCGGCCCAGCCCGG - Intronic
954410280 3:50367600-50367622 ACCCAAACCCTGCCCCTGCCAGG - Intronic
954453214 3:50582864-50582886 AGCCACTGGCTGCCCTGGCCTGG - Exonic
964891393 3:161540325-161540347 AGCCCAGGGCTGCCCCTGCCTGG - Intergenic
965132813 3:164723485-164723507 TGCCTATCCCTGCCCTGGCCTGG - Intergenic
968319266 3:197750588-197750610 AGCCATGGCCGGCGCCGGCCTGG - Intronic
969105978 4:4807340-4807362 AGCCGATGCCAGCCCAGCCCTGG - Intergenic
969448609 4:7259951-7259973 AGCCCCTGCCTGCACCAGCCTGG - Intronic
969647080 4:8437482-8437504 TGCCACTGCCTGGCCCCGCCAGG + Intronic
971050402 4:22855455-22855477 CGCCTATCCCTGCCCCGACCTGG - Intergenic
973373347 4:49270933-49270955 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
973387661 4:49524275-49524297 TGCCAGACCCTGCCCCGGCCTGG - Intergenic
977929452 4:102735186-102735208 AGGCACTGCCTACCCTGGCCTGG - Intronic
978776930 4:112514728-112514750 AGTCCATGTCTGACCCGGCCGGG + Exonic
983454072 4:167940723-167940745 AACCACTCCCTGGCCCGGCCAGG + Intergenic
984890342 4:184486465-184486487 AGTGAAAGCCTGCCTCGGCCAGG + Intergenic
990955324 5:61333370-61333392 AGACAATGCCGGCCGCGGCCCGG + Intronic
995778800 5:115754316-115754338 AGCCAATGCCTGGCCCTGAGAGG + Intergenic
996875361 5:128235093-128235115 AGCCTATCCCTGCCCCCACCTGG - Intergenic
997234796 5:132266554-132266576 AGACACTGCCTGGCCTGGCCTGG + Intronic
997584250 5:135035105-135035127 ACCCCATGCCTGCCAAGGCCAGG - Intronic
998406677 5:141878264-141878286 AGCCGCCGCCGGCCCCGGCCTGG + Exonic
998523115 5:142818298-142818320 AGCCAAGCCATGCCCCGGTCAGG + Intronic
999244648 5:150147420-150147442 AGCCCATGGCTGCTCCGGGCTGG - Intronic
999390349 5:151185238-151185260 AGCCACTGCTTGACCCAGCCTGG + Intronic
1000210406 5:159102328-159102350 AGTCAATCCCTCCCCCTGCCTGG + Intergenic
1000322499 5:160145969-160145991 AGCTAATGCCTGACCAGGCAGGG + Intergenic
1002134320 5:177098570-177098592 AGGCCATGCCCGCCCCGCCCTGG + Intergenic
1002173058 5:177386012-177386034 TGCCTATGCCTTCCCCAGCCTGG + Exonic
1002198244 5:177512706-177512728 ACCTAATGCCTTCCCCTGCCTGG - Intronic
1002921307 6:1575277-1575299 CCCCAGTGCCTGCCCTGGCCAGG + Intergenic
1003529962 6:6928986-6929008 CTCCAATGCCTGCACGGGCCAGG + Intergenic
1014139587 6:117925972-117925994 ACCCAATGCCAGCCCCAGCCTGG - Intronic
1015226004 6:130858235-130858257 AGCCAGTGCCTGCCAGGGTCAGG + Exonic
1018316459 6:162561735-162561757 AGCTGATGCCTGCCCATGCCAGG + Intronic
1019017433 6:168890162-168890184 AGCCAGTGCCTGCCCTGGTGGGG + Intergenic
1025067057 7:55866286-55866308 AACCAATGCCTGGCCGGGCGCGG + Intergenic
1029548450 7:101223603-101223625 AGCGAACACCTGCCCGGGCCAGG - Intronic
1030634845 7:111937162-111937184 AGCAAATGCCTGCCTGAGCCTGG - Intronic
1034590684 7:152136443-152136465 AGCCGATGGCTGCCCTGCCCCGG - Exonic
1043947201 8:86267765-86267787 AGCCATTTCCTGCCCTAGCCAGG + Intronic
1049182358 8:141229476-141229498 AGCCAGTGCCTTCCCCGGGTAGG + Intronic
1049194530 8:141308135-141308157 AGCCCCTGCCCGGCCCGGCCCGG - Intronic
1049501766 8:142971088-142971110 AGGCACTGCCTGCCCAGGCCTGG + Intergenic
1049801187 8:144518138-144518160 AGCCACTGCCTCCCTCGGCCAGG - Intronic
1053752283 9:41269078-41269100 AGCCAGACCCTGCCCCCGCCCGG + Intergenic
1054257809 9:62833410-62833432 AGCCAGACCCTGCCCCCGCCCGG + Intergenic
1054333513 9:63782354-63782376 AGCCAGACCCTGCCCCCGCCCGG - Intergenic
1056413438 9:86354400-86354422 AGCCTCTTCCTGTCCCGGCCGGG + Exonic
1057303078 9:93897475-93897497 GGCCCCTGCCTGCCCCAGCCTGG - Intergenic
1060477606 9:123998071-123998093 AGACACTGCCTGCCCACGCCTGG + Intergenic
1061038642 9:128127418-128127440 AGGTAAGGCCTGGCCCGGCCGGG - Exonic
1061091392 9:128428497-128428519 GGCCAATGCCCGCTCCGTCCAGG - Intronic
1061307041 9:129738085-129738107 ACCCAAATCCTGCCCCGGCCAGG - Intergenic
1062129168 9:134883460-134883482 AGCCAACGCCTGCCCAGGCAGGG + Intronic
1062157350 9:135060489-135060511 AGCCACTGTGTGCCCCAGCCTGG - Intergenic
1062218801 9:135403447-135403469 CCCCACTGCCTGCCACGGCCAGG + Intergenic
1062284130 9:135765570-135765592 AGCCAGCCCCTGCCCCGCCCGGG - Intronic
1062285185 9:135769685-135769707 GGCCAGGGCCTGCCCCGCCCTGG + Intronic
1062383813 9:136300259-136300281 AGCCAAGGCATCCCACGGCCAGG - Exonic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1203697056 Un_GL000214v1:108936-108958 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
1203552153 Un_KI270743v1:172093-172115 TGCCAGACCCTGCCCCGGCCCGG - Intergenic
1192528961 X:71870321-71870343 TGTCCATCCCTGCCCCGGCCAGG + Intergenic
1196904441 X:120418228-120418250 AGAAAATGCCTGTCCCGGCGCGG - Intergenic
1200039227 X:153353721-153353743 AGCCAATGCCTGCCCCGGCCTGG + Intronic
1200114563 X:153764531-153764553 AGCCAACGCCAGCCTCGGGCAGG + Intronic