ID: 1200039754

View in Genome Browser
Species Human (GRCh38)
Location X:153356293-153356315
Sequence ACCATTTGGCCCCTCCTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200039754_1200039766 20 Left 1200039754 X:153356293-153356315 CCAAATAGGAGGGGCCAAATGGT 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1200039766 X:153356336-153356358 CTGAACCTCAAGAAGCCTCAGGG 0: 1
1: 0
2: 4
3: 18
4: 175
1200039754_1200039765 19 Left 1200039754 X:153356293-153356315 CCAAATAGGAGGGGCCAAATGGT 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1200039765 X:153356335-153356357 CCTGAACCTCAAGAAGCCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200039754 Original CRISPR ACCATTTGGCCCCTCCTATT TGG (reversed) Intronic
902758064 1:18562294-18562316 TCCCTTTGGCCCCTCCCCTTAGG - Intergenic
904267194 1:29324898-29324920 ACTCTTTGGCCCCTCCTTTCTGG + Intronic
904335682 1:29796189-29796211 ACCACTTGGCCCCTGCTACCTGG - Intergenic
904724523 1:32537059-32537081 ACCATTTTGCTCCTTCTATCTGG + Intronic
906539690 1:46575840-46575862 GCCATTTTGCCCATCTTATTTGG - Intronic
908164128 1:61441004-61441026 AGGCTTTGGCCCCTCTTATTTGG - Intronic
909539037 1:76770472-76770494 CCCATTTGTCCCCACTTATTTGG + Intergenic
913248289 1:116889732-116889754 ACCATTTAGGGCCTCCTCTTGGG + Intergenic
920080664 1:203370555-203370577 ACCCTTTCGCCTCTCTTATTAGG - Intergenic
920545191 1:206810643-206810665 AGCATTTGGCCTCTGCTATATGG - Intronic
921026234 1:211285355-211285377 TCCATTTGGCCTCTCCAATTTGG + Intronic
923240073 1:232075850-232075872 CTCAATTGGCCCCTTCTATTAGG + Intergenic
1063539304 10:6915978-6916000 TCCATTCTGTCCCTCCTATTTGG - Intergenic
1066008357 10:31169173-31169195 ACTATTTGTCCTCTTCTATTTGG - Intergenic
1067808037 10:49406835-49406857 ACCAAGTGGCCCATCCTCTTGGG + Intergenic
1076557070 10:131333300-131333322 ATCATTTGGCTCATCATATTTGG + Intergenic
1077945831 11:6897078-6897100 ACAATTTGGCCCCTCCCCTCTGG - Intergenic
1079483730 11:20911722-20911744 TCCATGAGGCCACTCCTATTAGG - Intronic
1084040081 11:66537469-66537491 GCCTTTTGGCCCCACCTTTTGGG + Intronic
1089874829 11:121710847-121710869 AGCATTTGTCCCATCTTATTTGG - Intergenic
1092730351 12:11526904-11526926 ACCATTTCCCCCCTAATATTAGG - Intergenic
1094213283 12:27915168-27915190 CCAATTTGGCCCTCCCTATTTGG + Intergenic
1100343165 12:93700938-93700960 AGCATCTTGCACCTCCTATTTGG + Intronic
1108072556 13:46643146-46643168 CCCATTTGCTCCCTCTTATTTGG + Intronic
1112660376 13:101501116-101501138 ACCTTTTGGCTCCTGCTATTTGG + Intronic
1114307598 14:21437682-21437704 AAGATTTGGCCCCTTTTATTAGG - Intronic
1116740528 14:48748668-48748690 ACCATGCTGCCACTCCTATTTGG - Intergenic
1118976472 14:70681831-70681853 ACCAGTTGGCCCCACCAATCTGG - Intergenic
1131919579 15:97309628-97309650 GCCATTTGGCCCCACCTAAGAGG - Intergenic
1134630894 16:15755433-15755455 TCCAGTTGGCCCCGCCTGTTGGG + Intronic
1135284272 16:21180035-21180057 AACATTTGGCCTCTCCAAGTTGG + Exonic
1135405030 16:22191254-22191276 ACCCTTTGGCTTCTCCTTTTGGG + Exonic
1140974890 16:80050328-80050350 ACCATTTGTCTCCTGCAATTGGG - Intergenic
1144258041 17:13489341-13489363 ACTCTTTGGCCCCTGCTATTTGG - Intergenic
1148492622 17:48033095-48033117 ACCATTGGACCCCTTCTTTTAGG - Intronic
1151101083 17:71556013-71556035 GCCATTTGTCCACTCCTCTTAGG + Intergenic
1153751790 18:8239653-8239675 ACCTTTTGGTCTCTCCAATTTGG + Intronic
1158414918 18:57241878-57241900 ACCATTGTGTCCCTCCTATGAGG + Intergenic
1159026574 18:63187957-63187979 TCCATTTGGCCCCTGCTCATAGG + Intronic
1166358312 19:42240495-42240517 GCCCTCTGGCCCCTCCTATTTGG + Intronic
927417555 2:22894395-22894417 GCCATGTGGCCCCTCCTCTCAGG - Intergenic
929762095 2:44815116-44815138 ACCAGGAGGCCCCTCCTAATGGG - Intergenic
929977428 2:46648630-46648652 ATCATATGGCCCCTTCTGTTTGG + Intergenic
932324907 2:70852224-70852246 ACCCTTTGGCAAGTCCTATTGGG + Intergenic
933989704 2:87625397-87625419 ACCCTTTGGCCCCTGCTCTGAGG - Intergenic
936304140 2:111325429-111325451 ACCCTTTGGCCCCTGCTCTGAGG + Intergenic
936473698 2:112821599-112821621 ACAATTTTGCACCTCCTATCTGG + Intergenic
938653198 2:133405032-133405054 ACAACCTGGCCCCTCCTATAGGG + Intronic
941006267 2:160250399-160250421 ACACTTTGAACCCTCCTATTAGG - Intronic
941218221 2:162739970-162739992 ACTACTTGGCTCCTCTTATTTGG - Intronic
949037407 2:241822183-241822205 ACCCTTTGTCCCCTCCCATAAGG - Intergenic
1178663074 21:34522895-34522917 ACCATTTTGACCCTCCTCTGGGG - Intronic
949910788 3:8905830-8905852 CCCATGTGGCCCCTCTTAGTTGG + Intronic
951526111 3:23654715-23654737 ACCATTTGGAACTTCATATTAGG - Intergenic
964284428 3:155102001-155102023 ACCAATTCCCCCCTCCTAATAGG - Intronic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
977885333 4:102246279-102246301 GCCATATACCCCCTCCTATTTGG - Intergenic
987886517 5:23820444-23820466 ACCATTTGGCTCATGATATTAGG + Intergenic
992267638 5:75034265-75034287 ACCCTTGGGACCCTCCCATTGGG + Intergenic
993986792 5:94607028-94607050 GACATTTGTCCCCTCCTATTGGG - Intronic
995285730 5:110386127-110386149 GCCATTTGGTCACTCATATTTGG + Intronic
1001248430 5:170124431-170124453 AGCATTTGGTCCCTCCTATGAGG + Intergenic
1004009626 6:11669850-11669872 ACCATATTTCCCCTCCTACTTGG + Intergenic
1004128762 6:12899186-12899208 AAGATTTGGCCCCTCCTGTAAGG - Intronic
1007274523 6:40663554-40663576 CCCCTATGCCCCCTCCTATTGGG - Intergenic
1007602143 6:43089053-43089075 ATCATTAGGCCCCTACTATGAGG - Intronic
1012520716 6:100118208-100118230 ATCATCTGGCCCCTCCTAATGGG + Intergenic
1017531965 6:155302268-155302290 AGCATTTGGGCCCTACTATGTGG - Intronic
1028584993 7:92444064-92444086 ACCATCTGGCCTCTTCTAGTAGG - Intergenic
1036293912 8:7519626-7519648 ACCAAGTGTCCCCTCCTACTTGG - Intergenic
1036328650 8:7801365-7801387 ACCAAGTGTCCCCTCCTACTTGG + Intergenic
1039521025 8:38171718-38171740 ATCATTTGGCTCCCCCTACTGGG + Intronic
1041275855 8:56157114-56157136 TGCATTCGGCCCCTCCTGTTAGG - Intergenic
1044429015 8:92086927-92086949 TCCATCTGGCCCCTCACATTAGG + Intronic
1047684914 8:127295185-127295207 AGCATTTGGGCCCTCCTGATGGG - Intergenic
1049688832 8:143949985-143950007 CCCATGTGGCCCCTCCTCCTCGG - Intronic
1051148577 9:14056845-14056867 ACAATTTGGCCCATTATATTTGG - Intergenic
1058080975 9:100700796-100700818 ACCATTTGGTCCCCGCTGTTGGG - Intergenic
1186030493 X:5364117-5364139 ACTTTCTGGCCCCTCCTCTTAGG + Intergenic
1190885948 X:54531000-54531022 GCCAATTGCCCCCTCCTCTTAGG + Intronic
1197944988 X:131828766-131828788 TCTATCTGGACCCTCCTATTAGG - Intergenic
1200039754 X:153356293-153356315 ACCATTTGGCCCCTCCTATTTGG - Intronic