ID: 1200041660

View in Genome Browser
Species Human (GRCh38)
Location X:153375312-153375334
Sequence CACTCCCCCCAGAGGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200041660_1200041672 29 Left 1200041660 X:153375312-153375334 CCCTAGAGCCTCTGGGGGGAGTG No data
Right 1200041672 X:153375364-153375386 CTGGCCTCTAGGACTGGGAGAGG No data
1200041660_1200041664 -5 Left 1200041660 X:153375312-153375334 CCCTAGAGCCTCTGGGGGGAGTG No data
Right 1200041664 X:153375330-153375352 GAGTGTGGCCCTGAGACACCTGG No data
1200041660_1200041670 23 Left 1200041660 X:153375312-153375334 CCCTAGAGCCTCTGGGGGGAGTG No data
Right 1200041670 X:153375358-153375380 GAACTTCTGGCCTCTAGGACTGG No data
1200041660_1200041669 18 Left 1200041660 X:153375312-153375334 CCCTAGAGCCTCTGGGGGGAGTG No data
Right 1200041669 X:153375353-153375375 ATTTTGAACTTCTGGCCTCTAGG No data
1200041660_1200041667 10 Left 1200041660 X:153375312-153375334 CCCTAGAGCCTCTGGGGGGAGTG No data
Right 1200041667 X:153375345-153375367 ACACCTGGATTTTGAACTTCTGG No data
1200041660_1200041671 24 Left 1200041660 X:153375312-153375334 CCCTAGAGCCTCTGGGGGGAGTG No data
Right 1200041671 X:153375359-153375381 AACTTCTGGCCTCTAGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200041660 Original CRISPR CACTCCCCCCAGAGGCTCTA GGG (reversed) Intergenic
No off target data available for this crispr