ID: 1200043742

View in Genome Browser
Species Human (GRCh38)
Location X:153388585-153388607
Sequence CCCTCTGGAGGAGCTGCTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200043730_1200043742 28 Left 1200043730 X:153388534-153388556 CCCCAAAGCCCAGGGTGGCCTCT No data
Right 1200043742 X:153388585-153388607 CCCTCTGGAGGAGCTGCTCGAGG No data
1200043733_1200043742 20 Left 1200043733 X:153388542-153388564 CCCAGGGTGGCCTCTCAGTAATA No data
Right 1200043742 X:153388585-153388607 CCCTCTGGAGGAGCTGCTCGAGG No data
1200043732_1200043742 26 Left 1200043732 X:153388536-153388558 CCAAAGCCCAGGGTGGCCTCTCA No data
Right 1200043742 X:153388585-153388607 CCCTCTGGAGGAGCTGCTCGAGG No data
1200043731_1200043742 27 Left 1200043731 X:153388535-153388557 CCCAAAGCCCAGGGTGGCCTCTC No data
Right 1200043742 X:153388585-153388607 CCCTCTGGAGGAGCTGCTCGAGG No data
1200043734_1200043742 19 Left 1200043734 X:153388543-153388565 CCAGGGTGGCCTCTCAGTAATAC No data
Right 1200043742 X:153388585-153388607 CCCTCTGGAGGAGCTGCTCGAGG No data
1200043736_1200043742 10 Left 1200043736 X:153388552-153388574 CCTCTCAGTAATACTCAGGCTTC No data
Right 1200043742 X:153388585-153388607 CCCTCTGGAGGAGCTGCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200043742 Original CRISPR CCCTCTGGAGGAGCTGCTCG AGG Intergenic
No off target data available for this crispr