ID: 1200045857

View in Genome Browser
Species Human (GRCh38)
Location X:153400832-153400854
Sequence CTGTGGGGCTGGGGGTCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200045857_1200045872 14 Left 1200045857 X:153400832-153400854 CCTCCCGACCCCCAGCCCCACAG No data
Right 1200045872 X:153400869-153400891 CACCCCCTCACCCCAGCACTGGG No data
1200045857_1200045871 13 Left 1200045857 X:153400832-153400854 CCTCCCGACCCCCAGCCCCACAG No data
Right 1200045871 X:153400868-153400890 ACACCCCCTCACCCCAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200045857 Original CRISPR CTGTGGGGCTGGGGGTCGGG AGG (reversed) Intergenic
No off target data available for this crispr