ID: 1200045886

View in Genome Browser
Species Human (GRCh38)
Location X:153400920-153400942
Sequence AGAGGGTCGCCAAGCACGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200045886_1200045899 7 Left 1200045886 X:153400920-153400942 CCCCGCGTGCTTGGCGACCCTCT No data
Right 1200045899 X:153400950-153400972 GGGACCCAGGGGTCCTCCTCTGG No data
1200045886_1200045892 -6 Left 1200045886 X:153400920-153400942 CCCCGCGTGCTTGGCGACCCTCT No data
Right 1200045892 X:153400937-153400959 CCCTCTCCGCCCAGGGACCCAGG No data
1200045886_1200045904 23 Left 1200045886 X:153400920-153400942 CCCCGCGTGCTTGGCGACCCTCT No data
Right 1200045904 X:153400966-153400988 CCTCTGGCCACCCCGCACTGAGG No data
1200045886_1200045894 -5 Left 1200045886 X:153400920-153400942 CCCCGCGTGCTTGGCGACCCTCT No data
Right 1200045894 X:153400938-153400960 CCTCTCCGCCCAGGGACCCAGGG No data
1200045886_1200045895 -4 Left 1200045886 X:153400920-153400942 CCCCGCGTGCTTGGCGACCCTCT No data
Right 1200045895 X:153400939-153400961 CTCTCCGCCCAGGGACCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200045886 Original CRISPR AGAGGGTCGCCAAGCACGCG GGG (reversed) Intergenic