ID: 1200045888

View in Genome Browser
Species Human (GRCh38)
Location X:153400922-153400944
Sequence GGAGAGGGTCGCCAAGCACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200045888_1200045895 -6 Left 1200045888 X:153400922-153400944 CCGCGTGCTTGGCGACCCTCTCC No data
Right 1200045895 X:153400939-153400961 CTCTCCGCCCAGGGACCCAGGGG No data
1200045888_1200045894 -7 Left 1200045888 X:153400922-153400944 CCGCGTGCTTGGCGACCCTCTCC No data
Right 1200045894 X:153400938-153400960 CCTCTCCGCCCAGGGACCCAGGG No data
1200045888_1200045899 5 Left 1200045888 X:153400922-153400944 CCGCGTGCTTGGCGACCCTCTCC No data
Right 1200045899 X:153400950-153400972 GGGACCCAGGGGTCCTCCTCTGG No data
1200045888_1200045892 -8 Left 1200045888 X:153400922-153400944 CCGCGTGCTTGGCGACCCTCTCC No data
Right 1200045892 X:153400937-153400959 CCCTCTCCGCCCAGGGACCCAGG No data
1200045888_1200045904 21 Left 1200045888 X:153400922-153400944 CCGCGTGCTTGGCGACCCTCTCC No data
Right 1200045904 X:153400966-153400988 CCTCTGGCCACCCCGCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200045888 Original CRISPR GGAGAGGGTCGCCAAGCACG CGG (reversed) Intergenic
No off target data available for this crispr