ID: 1200045890

View in Genome Browser
Species Human (GRCh38)
Location X:153400930-153400952
Sequence TTGGCGACCCTCTCCGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200045881_1200045890 7 Left 1200045881 X:153400900-153400922 CCTCCCTCTTGCCTCTTCTACCC No data
Right 1200045890 X:153400930-153400952 TTGGCGACCCTCTCCGCCCAGGG No data
1200045877_1200045890 28 Left 1200045877 X:153400879-153400901 CCCCAGCACTGGGCGAGTCACCC No data
Right 1200045890 X:153400930-153400952 TTGGCGACCCTCTCCGCCCAGGG No data
1200045882_1200045890 4 Left 1200045882 X:153400903-153400925 CCCTCTTGCCTCTTCTACCCCGC No data
Right 1200045890 X:153400930-153400952 TTGGCGACCCTCTCCGCCCAGGG No data
1200045880_1200045890 8 Left 1200045880 X:153400899-153400921 CCCTCCCTCTTGCCTCTTCTACC No data
Right 1200045890 X:153400930-153400952 TTGGCGACCCTCTCCGCCCAGGG No data
1200045878_1200045890 27 Left 1200045878 X:153400880-153400902 CCCAGCACTGGGCGAGTCACCCT No data
Right 1200045890 X:153400930-153400952 TTGGCGACCCTCTCCGCCCAGGG No data
1200045883_1200045890 3 Left 1200045883 X:153400904-153400926 CCTCTTGCCTCTTCTACCCCGCG No data
Right 1200045890 X:153400930-153400952 TTGGCGACCCTCTCCGCCCAGGG No data
1200045879_1200045890 26 Left 1200045879 X:153400881-153400903 CCAGCACTGGGCGAGTCACCCTC No data
Right 1200045890 X:153400930-153400952 TTGGCGACCCTCTCCGCCCAGGG No data
1200045884_1200045890 -4 Left 1200045884 X:153400911-153400933 CCTCTTCTACCCCGCGTGCTTGG No data
Right 1200045890 X:153400930-153400952 TTGGCGACCCTCTCCGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200045890 Original CRISPR TTGGCGACCCTCTCCGCCCA GGG Intergenic
No off target data available for this crispr