ID: 1200045899

View in Genome Browser
Species Human (GRCh38)
Location X:153400950-153400972
Sequence GGGACCCAGGGGTCCTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200045882_1200045899 24 Left 1200045882 X:153400903-153400925 CCCTCTTGCCTCTTCTACCCCGC No data
Right 1200045899 X:153400950-153400972 GGGACCCAGGGGTCCTCCTCTGG No data
1200045883_1200045899 23 Left 1200045883 X:153400904-153400926 CCTCTTGCCTCTTCTACCCCGCG No data
Right 1200045899 X:153400950-153400972 GGGACCCAGGGGTCCTCCTCTGG No data
1200045891_1200045899 -10 Left 1200045891 X:153400937-153400959 CCCTCTCCGCCCAGGGACCCAGG No data
Right 1200045899 X:153400950-153400972 GGGACCCAGGGGTCCTCCTCTGG No data
1200045884_1200045899 16 Left 1200045884 X:153400911-153400933 CCTCTTCTACCCCGCGTGCTTGG No data
Right 1200045899 X:153400950-153400972 GGGACCCAGGGGTCCTCCTCTGG No data
1200045887_1200045899 6 Left 1200045887 X:153400921-153400943 CCCGCGTGCTTGGCGACCCTCTC No data
Right 1200045899 X:153400950-153400972 GGGACCCAGGGGTCCTCCTCTGG No data
1200045886_1200045899 7 Left 1200045886 X:153400920-153400942 CCCCGCGTGCTTGGCGACCCTCT No data
Right 1200045899 X:153400950-153400972 GGGACCCAGGGGTCCTCCTCTGG No data
1200045880_1200045899 28 Left 1200045880 X:153400899-153400921 CCCTCCCTCTTGCCTCTTCTACC No data
Right 1200045899 X:153400950-153400972 GGGACCCAGGGGTCCTCCTCTGG No data
1200045888_1200045899 5 Left 1200045888 X:153400922-153400944 CCGCGTGCTTGGCGACCCTCTCC No data
Right 1200045899 X:153400950-153400972 GGGACCCAGGGGTCCTCCTCTGG No data
1200045881_1200045899 27 Left 1200045881 X:153400900-153400922 CCTCCCTCTTGCCTCTTCTACCC No data
Right 1200045899 X:153400950-153400972 GGGACCCAGGGGTCCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200045899 Original CRISPR GGGACCCAGGGGTCCTCCTC TGG Intergenic
No off target data available for this crispr