ID: 1200045919

View in Genome Browser
Species Human (GRCh38)
Location X:153401008-153401030
Sequence CCTTCCAACCGCCCTCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200045902_1200045919 22 Left 1200045902 X:153400963-153400985 CCTCCTCTGGCCACCCCGCACTG No data
Right 1200045919 X:153401008-153401030 CCTTCCAACCGCCCTCCCGAGGG No data
1200045905_1200045919 12 Left 1200045905 X:153400973-153400995 CCACCCCGCACTGAGGAACCCCT No data
Right 1200045919 X:153401008-153401030 CCTTCCAACCGCCCTCCCGAGGG No data
1200045903_1200045919 19 Left 1200045903 X:153400966-153400988 CCTCTGGCCACCCCGCACTGAGG No data
Right 1200045919 X:153401008-153401030 CCTTCCAACCGCCCTCCCGAGGG No data
1200045906_1200045919 9 Left 1200045906 X:153400976-153400998 CCCCGCACTGAGGAACCCCTCCC No data
Right 1200045919 X:153401008-153401030 CCTTCCAACCGCCCTCCCGAGGG No data
1200045910_1200045919 -7 Left 1200045910 X:153400992-153401014 CCCTCCCCTCAGCCCTCCTTCCA No data
Right 1200045919 X:153401008-153401030 CCTTCCAACCGCCCTCCCGAGGG No data
1200045907_1200045919 8 Left 1200045907 X:153400977-153400999 CCCGCACTGAGGAACCCCTCCCC No data
Right 1200045919 X:153401008-153401030 CCTTCCAACCGCCCTCCCGAGGG No data
1200045901_1200045919 30 Left 1200045901 X:153400955-153400977 CCAGGGGTCCTCCTCTGGCCACC No data
Right 1200045919 X:153401008-153401030 CCTTCCAACCGCCCTCCCGAGGG No data
1200045911_1200045919 -8 Left 1200045911 X:153400993-153401015 CCTCCCCTCAGCCCTCCTTCCAA No data
Right 1200045919 X:153401008-153401030 CCTTCCAACCGCCCTCCCGAGGG No data
1200045908_1200045919 7 Left 1200045908 X:153400978-153401000 CCGCACTGAGGAACCCCTCCCCT No data
Right 1200045919 X:153401008-153401030 CCTTCCAACCGCCCTCCCGAGGG No data
1200045909_1200045919 -6 Left 1200045909 X:153400991-153401013 CCCCTCCCCTCAGCCCTCCTTCC No data
Right 1200045919 X:153401008-153401030 CCTTCCAACCGCCCTCCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200045919 Original CRISPR CCTTCCAACCGCCCTCCCGA GGG Intergenic
No off target data available for this crispr