ID: 1200046450

View in Genome Browser
Species Human (GRCh38)
Location X:153405351-153405373
Sequence CCAGCTACACCTCTTGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200046450_1200046454 -3 Left 1200046450 X:153405351-153405373 CCCCTTTCAAGAGGTGTAGCTGG No data
Right 1200046454 X:153405371-153405393 TGGATCCCTCTCCCTTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200046450 Original CRISPR CCAGCTACACCTCTTGAAAG GGG (reversed) Intergenic
No off target data available for this crispr