ID: 1200051376

View in Genome Browser
Species Human (GRCh38)
Location X:153433543-153433565
Sequence TCCGGGTTCCCTGGCAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200051361_1200051376 19 Left 1200051361 X:153433501-153433523 CCCAGGGGACCTGGGAAATGCCA No data
Right 1200051376 X:153433543-153433565 TCCGGGTTCCCTGGCAGGAGGGG No data
1200051356_1200051376 28 Left 1200051356 X:153433492-153433514 CCTCTCCGCCCCAGGGGACCTGG No data
Right 1200051376 X:153433543-153433565 TCCGGGTTCCCTGGCAGGAGGGG No data
1200051359_1200051376 23 Left 1200051359 X:153433497-153433519 CCGCCCCAGGGGACCTGGGAAAT No data
Right 1200051376 X:153433543-153433565 TCCGGGTTCCCTGGCAGGAGGGG No data
1200051362_1200051376 18 Left 1200051362 X:153433502-153433524 CCAGGGGACCTGGGAAATGCCAA No data
Right 1200051376 X:153433543-153433565 TCCGGGTTCCCTGGCAGGAGGGG No data
1200051365_1200051376 10 Left 1200051365 X:153433510-153433532 CCTGGGAAATGCCAAGGGTTCTT No data
Right 1200051376 X:153433543-153433565 TCCGGGTTCCCTGGCAGGAGGGG No data
1200051360_1200051376 20 Left 1200051360 X:153433500-153433522 CCCCAGGGGACCTGGGAAATGCC No data
Right 1200051376 X:153433543-153433565 TCCGGGTTCCCTGGCAGGAGGGG No data
1200051368_1200051376 -1 Left 1200051368 X:153433521-153433543 CCAAGGGTTCTTTTGCCGGGCTT No data
Right 1200051376 X:153433543-153433565 TCCGGGTTCCCTGGCAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200051376 Original CRISPR TCCGGGTTCCCTGGCAGGAG GGG Intergenic
No off target data available for this crispr