ID: 1200052392

View in Genome Browser
Species Human (GRCh38)
Location X:153441582-153441604
Sequence CAGATTAAACTGAAGAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200052391_1200052392 16 Left 1200052391 X:153441543-153441565 CCTAGACTTTAGAAAGAGGTGAA No data
Right 1200052392 X:153441582-153441604 CAGATTAAACTGAAGAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200052392 Original CRISPR CAGATTAAACTGAAGAATGC TGG Intergenic
No off target data available for this crispr