ID: 1200052477

View in Genome Browser
Species Human (GRCh38)
Location X:153442338-153442360
Sequence CCTGCCTGTCTGTCCCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200052471_1200052477 16 Left 1200052471 X:153442299-153442321 CCCTCCACAGAGGCGGCAGCAGC No data
Right 1200052477 X:153442338-153442360 CCTGCCTGTCTGTCCCATCCTGG No data
1200052466_1200052477 30 Left 1200052466 X:153442285-153442307 CCAAAACCAGAGACCCCTCCACA No data
Right 1200052477 X:153442338-153442360 CCTGCCTGTCTGTCCCATCCTGG No data
1200052475_1200052477 -6 Left 1200052475 X:153442321-153442343 CCAAAATCAGGCTGTCACCTGCC No data
Right 1200052477 X:153442338-153442360 CCTGCCTGTCTGTCCCATCCTGG No data
1200052470_1200052477 17 Left 1200052470 X:153442298-153442320 CCCCTCCACAGAGGCGGCAGCAG No data
Right 1200052477 X:153442338-153442360 CCTGCCTGTCTGTCCCATCCTGG No data
1200052468_1200052477 24 Left 1200052468 X:153442291-153442313 CCAGAGACCCCTCCACAGAGGCG No data
Right 1200052477 X:153442338-153442360 CCTGCCTGTCTGTCCCATCCTGG No data
1200052473_1200052477 12 Left 1200052473 X:153442303-153442325 CCACAGAGGCGGCAGCAGCCAAA No data
Right 1200052477 X:153442338-153442360 CCTGCCTGTCTGTCCCATCCTGG No data
1200052472_1200052477 15 Left 1200052472 X:153442300-153442322 CCTCCACAGAGGCGGCAGCAGCC No data
Right 1200052477 X:153442338-153442360 CCTGCCTGTCTGTCCCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200052477 Original CRISPR CCTGCCTGTCTGTCCCATCC TGG Intergenic
No off target data available for this crispr