ID: 1200053030

View in Genome Browser
Species Human (GRCh38)
Location X:153444780-153444802
Sequence ACGGGCCTGCTCATCGGCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200053018_1200053030 29 Left 1200053018 X:153444728-153444750 CCAGGCTGGGGTCATCAGGCGGC 0: 1
1: 0
2: 0
3: 11
4: 139
Right 1200053030 X:153444780-153444802 ACGGGCCTGCTCATCGGCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200053030 Original CRISPR ACGGGCCTGCTCATCGGCCC AGG Exonic
900679315 1:3907630-3907652 TCTGCCCTGCTCATGGGCCCTGG + Intergenic
900933054 1:5748579-5748601 ACGGCCCTGCGGATCAGCCCAGG - Intergenic
902477590 1:16696512-16696534 ACGGCCCTGCTCATCGTGCGTGG + Intergenic
902827821 1:18989154-18989176 AGGGGCCTTCTAATGGGCCCCGG - Intergenic
908615689 1:65919773-65919795 ACTGGGCTACTCATCAGCCCTGG - Intronic
909045715 1:70706836-70706858 CCTTGCCTGCTCATCGGCTCTGG + Intergenic
922776162 1:228215126-228215148 ACGGGGCTGCTCACCTGCCCCGG + Intronic
922792748 1:228319112-228319134 GCGGGCCAGCTCATCGGCCGTGG - Exonic
1067729136 10:48796581-48796603 ACGAGCCTGCCCAGAGGCCCTGG + Intronic
1070806014 10:79271137-79271159 ACAGGCCTGCTCATCTACTCAGG + Intronic
1074917485 10:117971529-117971551 ACTGGCTTGCTCATCTTCCCAGG - Intergenic
1075430364 10:122375027-122375049 CCGGGCCGGCTCACCTGCCCTGG + Intronic
1082797358 11:57387791-57387813 ACTGGGCTGCTCACCAGCCCTGG - Exonic
1090398459 11:126434137-126434159 AGGGGCCTGCACATCGCCCTAGG - Intronic
1096237909 12:49942405-49942427 TCGCCCCTGCTCATCGGGCCAGG - Intergenic
1103989723 12:124790796-124790818 ACGTGCCTGCACAGCGGCCCAGG - Intronic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1110534507 13:76635653-76635675 ATGGGCCTTCTCATCGACTCAGG - Intergenic
1113782711 13:112985902-112985924 ACGTGCCTGAGGATCGGCCCCGG + Intronic
1114494698 14:23124648-23124670 AGGGGCTTGCTCTTCCGCCCAGG + Intergenic
1125503832 15:40255438-40255460 AGGGTCCTGCTCATCCTCCCAGG + Intronic
1128283516 15:66417005-66417027 AAGGGCCTGCTCCTCAGCCTTGG - Intronic
1135294514 16:21267650-21267672 ACGGGTCTGTTCTTCGGTCCAGG - Exonic
1138183493 16:54959273-54959295 ATGTGCCTGCCCATGGGCCCAGG - Intergenic
1140484429 16:75282606-75282628 ATGGGGCTGCTCAGCGGACCTGG + Intergenic
1142229373 16:88892658-88892680 AAGGGCCAGCTCAGCTGCCCTGG - Intronic
1143513821 17:7409402-7409424 ACAGGACTGCTCATAGCCCCTGG + Intronic
1147188429 17:38725386-38725408 ACACCCCTGCGCATCGGCCCTGG + Intronic
1147625605 17:41897780-41897802 AGGCGCCACCTCATCGGCCCTGG + Exonic
1149634707 17:58157272-58157294 AAGGGCTTGATCAGCGGCCCGGG - Intergenic
1152259826 17:79260895-79260917 ACTGGCCTCCTCACTGGCCCTGG + Intronic
1160717294 19:582158-582180 TCGGGGCAGCTCATCAGCCCCGG - Intronic
1162639885 19:11999964-11999986 GCTGGGCTGCTCAACGGCCCTGG - Intergenic
1162796953 19:13092010-13092032 ACCTGCCTGCTCAGGGGCCCTGG - Intronic
1163313777 19:16529511-16529533 CCAGGCCTGCTCCTAGGCCCAGG - Intronic
1164402033 19:27909482-27909504 ACGGGGCTGCTCTTTTGCCCAGG + Intergenic
1166883128 19:45940896-45940918 GCGGGCCTGATCATCGGCAAGGG - Exonic
1167469427 19:49667082-49667104 AGGGGGCTGCTCCTCGCCCCAGG - Exonic
1202711610 1_KI270714v1_random:22338-22360 ACGGCCCTGCTCATCGTGCGTGG + Intergenic
925215905 2:2095759-2095781 ACGGCTCTCCTCATCGCCCCGGG + Intronic
935123832 2:100205374-100205396 ACAGGCCCTCACATCGGCCCAGG - Intergenic
940918884 2:159286542-159286564 ACGGGCCGGCTCAGCGGCGGTGG - Exonic
941442165 2:165552070-165552092 ACTGGCCTGCTCAGCAGCCTGGG - Intronic
943764993 2:191651105-191651127 ACTGCCCTGTTCATTGGCCCTGG - Intergenic
945003314 2:205375620-205375642 AAGGGCCTGCTCAAAGGCACTGG + Intronic
1172991499 20:39040319-39040341 AGGGGCCTCCCCATGGGCCCAGG - Intergenic
1174148400 20:48468568-48468590 TGGGTCCTGCTCAGCGGCCCTGG - Intergenic
1175401390 20:58701581-58701603 CCGGGGCTGCTCTTGGGCCCTGG - Intronic
1176206274 20:63890030-63890052 CCGGCTCTGCTCATCCGCCCTGG - Exonic
1176220333 20:63966636-63966658 ACCGGCCTGCTGATGGGCCCAGG + Exonic
1183520895 22:38295477-38295499 GGGGGCCTGCTCATGGGCACAGG + Intronic
954750855 3:52812841-52812863 ACAGGCCTGCTCCTCAGCACAGG + Intergenic
956872083 3:73428097-73428119 CCTGCCCTGCTCATCTGCCCTGG - Intronic
958470179 3:94507565-94507587 GCGGGCCTGCTGCTCGGCGCGGG - Intergenic
962023745 3:131526710-131526732 AGGGGGCTGCTCCTCGCCCCAGG - Intergenic
963067371 3:141274308-141274330 CCCGGCCTGCACATCGACCCTGG + Intronic
968515800 4:1015169-1015191 CCGGGCTTGCTGCTCGGCCCAGG + Intronic
985108819 4:186526514-186526536 ACGGTCTTGCTCTCCGGCCCAGG + Intronic
985762805 5:1759882-1759904 ACAGGCCTGCTCGCCTGCCCAGG + Intergenic
1002455249 5:179342596-179342618 ACGGGCGTGCTCAGGGGCCACGG + Intronic
1006582873 6:35086807-35086829 AGGGGCCTGCTCTTTGGCCGAGG + Intronic
1029814010 7:103075306-103075328 GCGGGCCTGCTGCTCGGCGCGGG + Exonic
1035221038 7:157406689-157406711 GCCGGCCAGCTCAGCGGCCCGGG + Intronic
1035744627 8:1952725-1952747 ACGAGCCTGCTCGTCTGCCACGG + Exonic
1044634723 8:94310898-94310920 ACTGACCCGCTCATCAGCCCTGG + Intergenic
1049427484 8:142543916-142543938 ACGAGCCTGCTCCTGGGGCCAGG + Intronic
1049675589 8:143887518-143887540 ACGGGTGTGCTCATGGGGCCTGG + Intergenic
1060941732 9:127546424-127546446 ACGGGCCTGGACACCTGCCCTGG + Intronic
1185835648 X:3344767-3344789 ACGCGCCTGCCCATTCGCCCGGG + Intronic
1200053030 X:153444780-153444802 ACGGGCCTGCTCATCGGCCCAGG + Exonic