ID: 1200053335

View in Genome Browser
Species Human (GRCh38)
Location X:153446015-153446037
Sequence CGGGCACTGACCGGCTTCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 83}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200053321_1200053335 6 Left 1200053321 X:153445986-153446008 CCAACCCCACCACACCAGCTTAC 0: 1
1: 0
2: 2
3: 47
4: 372
Right 1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 83
1200053331_1200053335 -8 Left 1200053331 X:153446000-153446022 CCAGCTTACCTGGGGCGGGCACT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 83
1200053320_1200053335 11 Left 1200053320 X:153445981-153446003 CCTTGCCAACCCCACCACACCAG 0: 1
1: 1
2: 4
3: 50
4: 623
Right 1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 83
1200053324_1200053335 1 Left 1200053324 X:153445991-153446013 CCCACCACACCAGCTTACCTGGG 0: 1
1: 0
2: 1
3: 24
4: 245
Right 1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 83
1200053326_1200053335 0 Left 1200053326 X:153445992-153446014 CCACCACACCAGCTTACCTGGGG 0: 1
1: 0
2: 0
3: 16
4: 221
Right 1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 83
1200053322_1200053335 2 Left 1200053322 X:153445990-153446012 CCCCACCACACCAGCTTACCTGG 0: 1
1: 0
2: 1
3: 34
4: 261
Right 1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 83
1200053318_1200053335 25 Left 1200053318 X:153445967-153445989 CCCGGGGAGACTGTCCTTGCCAA 0: 1
1: 0
2: 1
3: 15
4: 148
Right 1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 83
1200053328_1200053335 -3 Left 1200053328 X:153445995-153446017 CCACACCAGCTTACCTGGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 105
Right 1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 83
1200053319_1200053335 24 Left 1200053319 X:153445968-153445990 CCGGGGAGACTGTCCTTGCCAAC 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200053335 Original CRISPR CGGGCACTGACCGGCTTCCT GGG Exonic
900120572 1:1047025-1047047 CCGGCACTGACCTGCTGCCCAGG - Intronic
900652268 1:3735451-3735473 CGTGTTCTGGCCGGCTTCCTTGG - Exonic
901028218 1:6290456-6290478 CGGGCTGTGACCGGCTGCCATGG + Intronic
903064042 1:20688584-20688606 CGCACACTGGCAGGCTTCCTGGG + Intronic
915331117 1:155112900-155112922 AGGGCCCTGACAGGCTTCCCTGG - Intergenic
915572243 1:156751074-156751096 CGGGAAGTGACCGGCGCCCTCGG + Intronic
916582983 1:166124918-166124940 AGGGTACTGACCAGCTTGCTGGG - Intronic
917083812 1:171285320-171285342 CTGGCTCTGACCGTCTTCTTTGG + Exonic
1070130597 10:73653128-73653150 CAGGCACTCACTGGCTTGCTTGG + Exonic
1073307544 10:102515101-102515123 CTGCCGCTGACCGGCTTTCTGGG + Intronic
1074121517 10:110497481-110497503 GGGGCCCTGGCCGGCTCCCTCGG + Intergenic
1075270641 10:121046760-121046782 CGGTCGCTGACCTGCTTCATTGG + Intergenic
1075881352 10:125854676-125854698 CGGCCTCTGCCCAGCTTCCTGGG - Intronic
1076076236 10:127535949-127535971 GGGGCAGTGTCTGGCTTCCTGGG - Intergenic
1076688405 10:132208471-132208493 AGGGCACTGACTGGCACCCTGGG - Intronic
1076908480 10:133375261-133375283 CGGGAGCTGCCCGGCCTCCTGGG - Intergenic
1077383225 11:2257208-2257230 CCGGCACTGCCCGGCTGCCCTGG + Intergenic
1080668984 11:34358674-34358696 GAGGCACTCACAGGCTTCCTGGG - Intergenic
1088907495 11:114165664-114165686 CTGGCACTGACCCCTTTCCTGGG - Intronic
1096226597 12:49870151-49870173 AGGGCTCTGCCGGGCTTCCTGGG + Exonic
1100819399 12:98417256-98417278 CGGGGACTGAGAGGCTTCCCAGG + Intergenic
1109868188 13:68294646-68294668 AGGGCACTGCCCGGATCCCTGGG - Intergenic
1113680766 13:112243139-112243161 TGGGCACTGACCGGCCTCTTGGG - Intergenic
1113932485 13:113975663-113975685 CTGGCACTGCCTGGCCTCCTGGG + Intergenic
1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG + Intronic
1124237549 15:28003433-28003455 GGGGCACGGACGGGCGTCCTGGG - Intronic
1128021073 15:64390920-64390942 CGGGCACTGACCTCCTTCCCAGG - Intronic
1129677970 15:77642630-77642652 GGGGCTCTGAAGGGCTTCCTAGG - Intronic
1131081924 15:89543801-89543823 TGGGTACTGACCTGCTGCCTGGG + Intergenic
1132063147 15:98709269-98709291 CGGGAACTGAAGGGCTACCTGGG - Intronic
1133017586 16:2951417-2951439 TGGGCACTGACCGCCCTCCCAGG + Intergenic
1136284020 16:29230814-29230836 CGGGCACTGCCTGGGTTGCTTGG + Intergenic
1141587902 16:85047368-85047390 CGAGCACTTTCCGGTTTCCTGGG + Intronic
1142260636 16:89041059-89041081 TGGGCACTGACCGGAGTCCAGGG - Intergenic
1142262252 16:89048465-89048487 GGGGCACTGGCCGGATCCCTGGG + Intergenic
1143167193 17:4902680-4902702 CCCGCACTGGCCGGCTTCCTGGG + Exonic
1145264955 17:21375467-21375489 TGGGCACAGACTGGCCTCCTCGG + Intergenic
1150221120 17:63496492-63496514 CAGGCGCTGCCCGGCCTCCTTGG - Exonic
1152249050 17:79202095-79202117 GGTGCACTGACAGGCTTCCCCGG + Intronic
1153451888 18:5238699-5238721 TGGGCAGTGACCGGGTTGCTGGG - Intergenic
1164922885 19:32102879-32102901 GGGGCACTGACAGTCTTCCCAGG - Intergenic
1165832787 19:38737441-38737463 GGGGCCCTGAGAGGCTTCCTGGG - Intronic
1167557157 19:50203660-50203682 CGGGCACTCACCGGCTTCCAGGG - Exonic
924991531 2:316734-316756 TGGGCACTGACCTGCTGCCATGG - Intergenic
925180027 2:1811557-1811579 CAGGGACTGTCCGGATTCCTGGG - Intronic
926476694 2:13330750-13330772 ATGGCACTGACTGGGTTCCTTGG - Intergenic
935218110 2:100990389-100990411 CTGGCACTGGCTGGCATCCTGGG - Exonic
938560854 2:132470748-132470770 AGGGCACGGAAAGGCTTCCTGGG + Intronic
948396461 2:237648739-237648761 CAGGCTCTGACCTCCTTCCTGGG - Intronic
948752929 2:240142971-240142993 CATGCACTGTCCTGCTTCCTGGG + Intronic
1172136564 20:32690361-32690383 CGTGGCCTGACTGGCTTCCTGGG - Intergenic
1173504510 20:43576289-43576311 CGGCCACTGTCCGGCCTCCGGGG - Exonic
1174940171 20:54918318-54918340 CTTGCACTGACTGGGTTCCTGGG + Intergenic
1180248792 21:46565827-46565849 TGGGCAAGGACCGGCTACCTTGG + Exonic
1185078185 22:48694549-48694571 CGGACACAGCCGGGCTTCCTGGG - Intronic
953975687 3:47380432-47380454 TGGGCACTGCCCGGCCTCCCAGG + Intergenic
954369546 3:50163005-50163027 CGGGGGCTGAGCGGCTTCCCAGG + Intronic
956688316 3:71853190-71853212 CGGGGACTTACCTGCTTCCCAGG + Intergenic
961628497 3:128279781-128279803 CTGCCCCTGACTGGCTTCCTGGG + Intronic
968976410 4:3824442-3824464 TGGGAACTGCCCGGCTTCGTGGG - Intergenic
981154320 4:141415970-141415992 CGGAAACTAACAGGCTTCCTTGG - Intergenic
981809230 4:148754305-148754327 TGGGGACTCACCTGCTTCCTGGG + Intergenic
985711514 5:1432215-1432237 GGGGCACTGAGCAGCTCCCTTGG - Intronic
987310732 5:16678916-16678938 CCGGGACTGACCGGCTACGTGGG + Intronic
995981645 5:118111735-118111757 CTGGCACTGACCTCCTTCCCTGG - Intergenic
998405854 5:141874392-141874414 CGGGCCCTGGCTGCCTTCCTGGG + Intronic
1002268839 5:178056100-178056122 AGGGCACTTGCCTGCTTCCTTGG - Intergenic
1002457669 5:179354870-179354892 GGGCCACTGACCTGCCTCCTGGG + Intergenic
1004191340 6:13466468-13466490 CTGCCACTGACAGGCTCCCTCGG - Intronic
1007749671 6:44064246-44064268 CGGGCACTCACGGTCTTCCTCGG - Intergenic
1008092714 6:47309272-47309294 CGGGCACTGAGGGGTTTCCAAGG - Intronic
1008773738 6:55009585-55009607 CGCTCACTCACCGCCTTCCTTGG + Intergenic
1021571121 7:22066221-22066243 CTAGCACTGACTGTCTTCCTAGG - Intergenic
1022472301 7:30689267-30689289 CTGGCTCTGCCCGGCTGCCTAGG + Exonic
1023887946 7:44374400-44374422 AAGGCACTGGCAGGCTTCCTGGG - Intergenic
1028446830 7:90934112-90934134 TGGGCACTGACCGCCTTTCCAGG - Intronic
1032571710 7:133007483-133007505 TGGACACTGACCTGCTTGCTAGG - Intronic
1035601293 8:898388-898410 CGGCCAATGACCGCCTTCCAGGG - Intergenic
1037769224 8:21789200-21789222 CTGGGACTGACCTGCTGCCTTGG + Intronic
1049163280 8:141111285-141111307 CTGGGACTGAGCGACTTCCTGGG + Intergenic
1055445651 9:76379699-76379721 AGGGCACTGAGCGGATTCCCAGG - Intergenic
1059458521 9:114414875-114414897 TGGGCACTCAGCAGCTTCCTGGG + Intronic
1059883176 9:118714973-118714995 CAGGCATTGACCTTCTTCCTTGG + Intergenic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1188550529 X:31359698-31359720 CAGGCACTGACCTGGGTCCTGGG - Intronic
1192141803 X:68652560-68652582 CGGGCCCTGACTGGCCTCCAGGG - Intronic
1194746778 X:97636801-97636823 TGGGCCCTGACCCTCTTCCTTGG + Intergenic
1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG + Exonic
1200155171 X:153971266-153971288 CCAGCACTGGCCGGCTTCCGGGG + Exonic