ID: 1200053908

View in Genome Browser
Species Human (GRCh38)
Location X:153448817-153448839
Sequence ACAGACCCTGGCCTGGGTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200053908_1200053923 27 Left 1200053908 X:153448817-153448839 CCGAGACCCAGGCCAGGGTCTGT No data
Right 1200053923 X:153448867-153448889 CCCCCTGCCCCCCAAGCCCCAGG No data
1200053908_1200053925 28 Left 1200053908 X:153448817-153448839 CCGAGACCCAGGCCAGGGTCTGT No data
Right 1200053925 X:153448868-153448890 CCCCTGCCCCCCAAGCCCCAGGG No data
1200053908_1200053927 29 Left 1200053908 X:153448817-153448839 CCGAGACCCAGGCCAGGGTCTGT No data
Right 1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200053908 Original CRISPR ACAGACCCTGGCCTGGGTCT CGG (reversed) Intronic